ID: 965133073

View in Genome Browser
Species Human (GRCh38)
Location 3:164726214-164726236
Sequence GGTCCAGGTAGAGAGGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965133073_965133080 22 Left 965133073 3:164726214-164726236 CCAGTGGCCTCTCTACCTGGACC No data
Right 965133080 3:164726259-164726281 TTGGTCCCTGAAGCTCTCCTGGG No data
965133073_965133079 21 Left 965133073 3:164726214-164726236 CCAGTGGCCTCTCTACCTGGACC No data
Right 965133079 3:164726258-164726280 CTTGGTCCCTGAAGCTCTCCTGG No data
965133073_965133077 3 Left 965133073 3:164726214-164726236 CCAGTGGCCTCTCTACCTGGACC No data
Right 965133077 3:164726240-164726262 CTTCCACAGAGCTATGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965133073 Original CRISPR GGTCCAGGTAGAGAGGCCAC TGG (reversed) Intergenic
No off target data available for this crispr