ID: 965134352

View in Genome Browser
Species Human (GRCh38)
Location 3:164742112-164742134
Sequence CCCAGGTGGCAGGATTGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965134352_965134361 21 Left 965134352 3:164742112-164742134 CCGGGGCAATCCTGCCACCTGGG No data
Right 965134361 3:164742156-164742178 AGCCTGCTTCTACCTGGACAAGG No data
965134352_965134358 15 Left 965134352 3:164742112-164742134 CCGGGGCAATCCTGCCACCTGGG No data
Right 965134358 3:164742150-164742172 TTGCCCAGCCTGCTTCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965134352 Original CRISPR CCCAGGTGGCAGGATTGCCC CGG (reversed) Intergenic