ID: 965134354

View in Genome Browser
Species Human (GRCh38)
Location 3:164742122-164742144
Sequence GCTTGTGTGACCCAGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965134354_965134358 5 Left 965134354 3:164742122-164742144 CCTGCCACCTGGGTCACACAAGC No data
Right 965134358 3:164742150-164742172 TTGCCCAGCCTGCTTCTACCTGG No data
965134354_965134366 28 Left 965134354 3:164742122-164742144 CCTGCCACCTGGGTCACACAAGC No data
Right 965134366 3:164742173-164742195 ACAAGGTCCTGCTCACCTAGGGG No data
965134354_965134364 26 Left 965134354 3:164742122-164742144 CCTGCCACCTGGGTCACACAAGC No data
Right 965134364 3:164742171-164742193 GGACAAGGTCCTGCTCACCTAGG No data
965134354_965134365 27 Left 965134354 3:164742122-164742144 CCTGCCACCTGGGTCACACAAGC No data
Right 965134365 3:164742172-164742194 GACAAGGTCCTGCTCACCTAGGG No data
965134354_965134361 11 Left 965134354 3:164742122-164742144 CCTGCCACCTGGGTCACACAAGC No data
Right 965134361 3:164742156-164742178 AGCCTGCTTCTACCTGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965134354 Original CRISPR GCTTGTGTGACCCAGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr