ID: 965134355

View in Genome Browser
Species Human (GRCh38)
Location 3:164742126-164742148
Sequence TGAGGCTTGTGTGACCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965134355_965134364 22 Left 965134355 3:164742126-164742148 CCACCTGGGTCACACAAGCCTCA No data
Right 965134364 3:164742171-164742193 GGACAAGGTCCTGCTCACCTAGG No data
965134355_965134365 23 Left 965134355 3:164742126-164742148 CCACCTGGGTCACACAAGCCTCA No data
Right 965134365 3:164742172-164742194 GACAAGGTCCTGCTCACCTAGGG No data
965134355_965134361 7 Left 965134355 3:164742126-164742148 CCACCTGGGTCACACAAGCCTCA No data
Right 965134361 3:164742156-164742178 AGCCTGCTTCTACCTGGACAAGG No data
965134355_965134366 24 Left 965134355 3:164742126-164742148 CCACCTGGGTCACACAAGCCTCA No data
Right 965134366 3:164742173-164742195 ACAAGGTCCTGCTCACCTAGGGG No data
965134355_965134358 1 Left 965134355 3:164742126-164742148 CCACCTGGGTCACACAAGCCTCA No data
Right 965134358 3:164742150-164742172 TTGCCCAGCCTGCTTCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965134355 Original CRISPR TGAGGCTTGTGTGACCCAGG TGG (reversed) Intergenic