ID: 965134357

View in Genome Browser
Species Human (GRCh38)
Location 3:164742144-164742166
Sequence AGAAGCAGGCTGGGCAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965134357_965134365 5 Left 965134357 3:164742144-164742166 CCTCATTTGCCCAGCCTGCTTCT No data
Right 965134365 3:164742172-164742194 GACAAGGTCCTGCTCACCTAGGG No data
965134357_965134364 4 Left 965134357 3:164742144-164742166 CCTCATTTGCCCAGCCTGCTTCT No data
Right 965134364 3:164742171-164742193 GGACAAGGTCCTGCTCACCTAGG No data
965134357_965134366 6 Left 965134357 3:164742144-164742166 CCTCATTTGCCCAGCCTGCTTCT No data
Right 965134366 3:164742173-164742195 ACAAGGTCCTGCTCACCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965134357 Original CRISPR AGAAGCAGGCTGGGCAAATG AGG (reversed) Intergenic