ID: 965134359 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:164742153-164742175 |
| Sequence | TGTCCAGGTAGAAGCAGGCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 965134359_965134365 | -4 | Left | 965134359 | 3:164742153-164742175 | CCCAGCCTGCTTCTACCTGGACA | No data | ||
| Right | 965134365 | 3:164742172-164742194 | GACAAGGTCCTGCTCACCTAGGG | No data | ||||
| 965134359_965134366 | -3 | Left | 965134359 | 3:164742153-164742175 | CCCAGCCTGCTTCTACCTGGACA | No data | ||
| Right | 965134366 | 3:164742173-164742195 | ACAAGGTCCTGCTCACCTAGGGG | No data | ||||
| 965134359_965134364 | -5 | Left | 965134359 | 3:164742153-164742175 | CCCAGCCTGCTTCTACCTGGACA | No data | ||
| Right | 965134364 | 3:164742171-164742193 | GGACAAGGTCCTGCTCACCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 965134359 | Original CRISPR | TGTCCAGGTAGAAGCAGGCT GGG (reversed) | Intergenic | ||