ID: 965134361

View in Genome Browser
Species Human (GRCh38)
Location 3:164742156-164742178
Sequence AGCCTGCTTCTACCTGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965134356_965134361 4 Left 965134356 3:164742129-164742151 CCTGGGTCACACAAGCCTCATTT No data
Right 965134361 3:164742156-164742178 AGCCTGCTTCTACCTGGACAAGG No data
965134350_965134361 22 Left 965134350 3:164742111-164742133 CCCGGGGCAATCCTGCCACCTGG No data
Right 965134361 3:164742156-164742178 AGCCTGCTTCTACCTGGACAAGG No data
965134352_965134361 21 Left 965134352 3:164742112-164742134 CCGGGGCAATCCTGCCACCTGGG No data
Right 965134361 3:164742156-164742178 AGCCTGCTTCTACCTGGACAAGG No data
965134354_965134361 11 Left 965134354 3:164742122-164742144 CCTGCCACCTGGGTCACACAAGC No data
Right 965134361 3:164742156-164742178 AGCCTGCTTCTACCTGGACAAGG No data
965134355_965134361 7 Left 965134355 3:164742126-164742148 CCACCTGGGTCACACAAGCCTCA No data
Right 965134361 3:164742156-164742178 AGCCTGCTTCTACCTGGACAAGG No data
965134349_965134361 30 Left 965134349 3:164742103-164742125 CCATCAGACCCGGGGCAATCCTG No data
Right 965134361 3:164742156-164742178 AGCCTGCTTCTACCTGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965134361 Original CRISPR AGCCTGCTTCTACCTGGACA AGG Intergenic