ID: 965134362

View in Genome Browser
Species Human (GRCh38)
Location 3:164742158-164742180
Sequence GACCTTGTCCAGGTAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965134362_965134364 -10 Left 965134362 3:164742158-164742180 CCTGCTTCTACCTGGACAAGGTC No data
Right 965134364 3:164742171-164742193 GGACAAGGTCCTGCTCACCTAGG No data
965134362_965134366 -8 Left 965134362 3:164742158-164742180 CCTGCTTCTACCTGGACAAGGTC No data
Right 965134366 3:164742173-164742195 ACAAGGTCCTGCTCACCTAGGGG No data
965134362_965134365 -9 Left 965134362 3:164742158-164742180 CCTGCTTCTACCTGGACAAGGTC No data
Right 965134365 3:164742172-164742194 GACAAGGTCCTGCTCACCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965134362 Original CRISPR GACCTTGTCCAGGTAGAAGC AGG (reversed) Intergenic