ID: 965134364

View in Genome Browser
Species Human (GRCh38)
Location 3:164742171-164742193
Sequence GGACAAGGTCCTGCTCACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965134357_965134364 4 Left 965134357 3:164742144-164742166 CCTCATTTGCCCAGCCTGCTTCT No data
Right 965134364 3:164742171-164742193 GGACAAGGTCCTGCTCACCTAGG No data
965134355_965134364 22 Left 965134355 3:164742126-164742148 CCACCTGGGTCACACAAGCCTCA No data
Right 965134364 3:164742171-164742193 GGACAAGGTCCTGCTCACCTAGG No data
965134360_965134364 -6 Left 965134360 3:164742154-164742176 CCAGCCTGCTTCTACCTGGACAA No data
Right 965134364 3:164742171-164742193 GGACAAGGTCCTGCTCACCTAGG No data
965134356_965134364 19 Left 965134356 3:164742129-164742151 CCTGGGTCACACAAGCCTCATTT No data
Right 965134364 3:164742171-164742193 GGACAAGGTCCTGCTCACCTAGG No data
965134354_965134364 26 Left 965134354 3:164742122-164742144 CCTGCCACCTGGGTCACACAAGC No data
Right 965134364 3:164742171-164742193 GGACAAGGTCCTGCTCACCTAGG No data
965134359_965134364 -5 Left 965134359 3:164742153-164742175 CCCAGCCTGCTTCTACCTGGACA No data
Right 965134364 3:164742171-164742193 GGACAAGGTCCTGCTCACCTAGG No data
965134362_965134364 -10 Left 965134362 3:164742158-164742180 CCTGCTTCTACCTGGACAAGGTC No data
Right 965134364 3:164742171-164742193 GGACAAGGTCCTGCTCACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965134364 Original CRISPR GGACAAGGTCCTGCTCACCT AGG Intergenic