ID: 965134672

View in Genome Browser
Species Human (GRCh38)
Location 3:164747362-164747384
Sequence TTGAATATGAAAAATGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965134670_965134672 22 Left 965134670 3:164747317-164747339 CCTGATATGGAAAGGCACATTAA No data
Right 965134672 3:164747362-164747384 TTGAATATGAAAAATGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965134672 Original CRISPR TTGAATATGAAAAATGAGGC AGG Intergenic
No off target data available for this crispr