ID: 965144236

View in Genome Browser
Species Human (GRCh38)
Location 3:164879031-164879053
Sequence GAGAGAGAGTGGGTAAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965144236_965144239 -4 Left 965144236 3:164879031-164879053 CCTCATCTTACCCACTCTCTCTC No data
Right 965144239 3:164879050-164879072 TCTCTATTGATTCCGAGTGATGG No data
965144236_965144241 19 Left 965144236 3:164879031-164879053 CCTCATCTTACCCACTCTCTCTC No data
Right 965144241 3:164879073-164879095 ATGCCCTTTAACCAATTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965144236 Original CRISPR GAGAGAGAGTGGGTAAGATG AGG (reversed) Intergenic