ID: 965144237

View in Genome Browser
Species Human (GRCh38)
Location 3:164879041-164879063
Sequence GGAATCAATAGAGAGAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965144237_965144241 9 Left 965144237 3:164879041-164879063 CCCACTCTCTCTCTATTGATTCC No data
Right 965144241 3:164879073-164879095 ATGCCCTTTAACCAATTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965144237 Original CRISPR GGAATCAATAGAGAGAGAGT GGG (reversed) Intergenic