ID: 965144238

View in Genome Browser
Species Human (GRCh38)
Location 3:164879042-164879064
Sequence CGGAATCAATAGAGAGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965144238_965144241 8 Left 965144238 3:164879042-164879064 CCACTCTCTCTCTATTGATTCCG No data
Right 965144241 3:164879073-164879095 ATGCCCTTTAACCAATTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965144238 Original CRISPR CGGAATCAATAGAGAGAGAG TGG (reversed) Intergenic