ID: 965144241

View in Genome Browser
Species Human (GRCh38)
Location 3:164879073-164879095
Sequence ATGCCCTTTAACCAATTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965144238_965144241 8 Left 965144238 3:164879042-164879064 CCACTCTCTCTCTATTGATTCCG No data
Right 965144241 3:164879073-164879095 ATGCCCTTTAACCAATTGAATGG No data
965144236_965144241 19 Left 965144236 3:164879031-164879053 CCTCATCTTACCCACTCTCTCTC No data
Right 965144241 3:164879073-164879095 ATGCCCTTTAACCAATTGAATGG No data
965144237_965144241 9 Left 965144237 3:164879041-164879063 CCCACTCTCTCTCTATTGATTCC No data
Right 965144241 3:164879073-164879095 ATGCCCTTTAACCAATTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965144241 Original CRISPR ATGCCCTTTAACCAATTGAA TGG Intergenic