ID: 965148378

View in Genome Browser
Species Human (GRCh38)
Location 3:164937099-164937121
Sequence CCTTTACTAGTCAAAGAACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965148375_965148378 5 Left 965148375 3:164937071-164937093 CCTATCACTTTTAACTGCCTGCA No data
Right 965148378 3:164937099-164937121 CCTTTACTAGTCAAAGAACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965148378 Original CRISPR CCTTTACTAGTCAAAGAACG AGG Intergenic
No off target data available for this crispr