ID: 965148768

View in Genome Browser
Species Human (GRCh38)
Location 3:164942755-164942777
Sequence CACACTGATTTGTTCAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965148766_965148768 -9 Left 965148766 3:164942741-164942763 CCTATCTACTTGATCACACTGAT No data
Right 965148768 3:164942755-164942777 CACACTGATTTGTTCAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965148768 Original CRISPR CACACTGATTTGTTCAAGGA TGG Intergenic
No off target data available for this crispr