ID: 965154167

View in Genome Browser
Species Human (GRCh38)
Location 3:165025377-165025399
Sequence CTGGTGTTCCTGAGGAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 3, 1: 4, 2: 19, 3: 44, 4: 302}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965154163_965154167 -7 Left 965154163 3:165025361-165025383 CCAAACCTAAGAATAGCTGGTGT 0: 3
1: 38
2: 351
3: 464
4: 602
Right 965154167 3:165025377-165025399 CTGGTGTTCCTGAGGAAGAAGGG 0: 3
1: 4
2: 19
3: 44
4: 302
965154161_965154167 24 Left 965154161 3:165025330-165025352 CCTGCAAGAAGTCTGGGATTATG 0: 4
1: 232
2: 351
3: 780
4: 7365
Right 965154167 3:165025377-165025399 CTGGTGTTCCTGAGGAAGAAGGG 0: 3
1: 4
2: 19
3: 44
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965154167 Original CRISPR CTGGTGTTCCTGAGGAAGAA GGG Intronic
900521220 1:3106369-3106391 CTGGTGCTTCTGAGGAGGACTGG + Intronic
900921111 1:5671200-5671222 CCTGTGTCCCTGAGGGAGAAGGG + Intergenic
901218494 1:7568311-7568333 CTGGTGATCCTGATGAGGGATGG - Intronic
902034959 1:13450982-13451004 CAGTTGTTTCTAAGGAAGAAAGG + Intergenic
902874341 1:19331875-19331897 CTGGTGTTTCCCAGGAGGAAGGG - Intergenic
903306011 1:22413815-22413837 CTGGTGACTCTGATGAAGAAAGG + Intergenic
905913371 1:41669012-41669034 CTGGAGTTCCTGAGGGATCATGG - Intronic
907987745 1:59549205-59549227 CTGGAGTTCCTGGAGAGGAAGGG - Intronic
908107098 1:60856236-60856258 CTGTTGTTTCTGAAGGAGAAGGG + Intergenic
908265091 1:62370786-62370808 CTGGTGTTCCTTAGGTAAAGAGG + Intergenic
909339927 1:74520381-74520403 CTGGAGGGGCTGAGGAAGAAAGG - Intronic
911168280 1:94744628-94744650 CTGGTTCTCCTGAGCCAGAATGG - Intergenic
911311465 1:96297063-96297085 CTGTTGTGCCTGAGAAAGATGGG - Intergenic
913349734 1:117843997-117844019 CTGGTGTTCCTGAAAGAGACGGG + Intergenic
913358586 1:117952634-117952656 CTCTTATTCTTGAGGAAGAAAGG + Exonic
913519842 1:119634339-119634361 TTGGTGTTGTTGATGAAGAATGG + Intronic
915119368 1:153619075-153619097 CTGGGGTTCTTGAGAAAGTAGGG + Intronic
915358704 1:155272815-155272837 CTGGATTTTCTGAGTAAGAAAGG - Intronic
915487826 1:156234333-156234355 CTGTTGGTCCTGTGGGAGAAAGG + Intronic
917237019 1:172904820-172904842 CTGATATCCCTGAGGAAGGAAGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917582171 1:176390330-176390352 CTGGAGTACCTGAAGGAGAAGGG - Intergenic
918013649 1:180611213-180611235 CTGCTGTTGCTGGGGAAGAAAGG - Intergenic
918721705 1:187860603-187860625 TAGGCCTTCCTGAGGAAGAAAGG - Intergenic
919505121 1:198388674-198388696 GTCGTTTGCCTGAGGAAGAAAGG - Intergenic
920863378 1:209730370-209730392 CTGAGGTTCCTTAGGAGGAAAGG + Intronic
921146620 1:212364260-212364282 CTGGTGTCCCCGAGGAAGCTGGG - Intronic
921335038 1:214077122-214077144 CCTGTGTTCCTGAGAGAGAAAGG + Intergenic
921546146 1:216477270-216477292 CTGTGGTACCTGAGGAAGAATGG - Intergenic
922244615 1:223783392-223783414 CTGCTGTTGGTGAGGAAGTAAGG - Intronic
923042205 1:230327430-230327452 CTGCTGTTTCTGAGGAAAGAAGG - Intronic
923982845 1:239345154-239345176 CTGTTATTCATGAGTAAGAATGG - Intergenic
1063688233 10:8258730-8258752 ATTCTGTTCCTGTGGAAGAAGGG + Intergenic
1064639286 10:17398955-17398977 GTAGTTTTCCTGAGGGAGAAAGG + Intronic
1066422422 10:35275372-35275394 CTGTTGTTCCTGTGAGAGAAAGG + Intronic
1066446078 10:35485001-35485023 CTGATGTTCCAGAAGAGGAAAGG - Intronic
1066602865 10:37126085-37126107 CTGGGGGGCCTGGGGAAGAAGGG + Intronic
1067401226 10:45975637-45975659 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1067869578 10:49945215-49945237 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1068053458 10:51981929-51981951 CTGGTGTCCCTGAAGGAGACAGG - Intronic
1068144107 10:53044348-53044370 CTGGGGTTCCTGAGGAAGATGGG - Intergenic
1070025064 10:72624630-72624652 CTTGTGTGCCTGAGGAGAAAGGG - Intronic
1070127848 10:73636188-73636210 ATGGTATAGCTGAGGAAGAAGGG - Intronic
1070218884 10:74419189-74419211 CTGTTGTTGGGGAGGAAGAATGG - Intronic
1070795638 10:79214833-79214855 CTGCTGTTCATGAGGAAGGCGGG + Intronic
1071056946 10:81522527-81522549 GTGGTGTGCCAGAGAAAGAATGG - Intergenic
1072718414 10:97766506-97766528 CTTTTGTCCCTGAGGAGGAATGG - Intergenic
1074467049 10:113692522-113692544 CTGGTCTGCCTGAGAAACAAAGG + Intronic
1074659466 10:115636366-115636388 CTGGTGTTACCTGGGAAGAATGG - Intronic
1074986127 10:118661519-118661541 GTGGTGTTCCTGAGGAAGAAGGG - Intergenic
1076134546 10:128036397-128036419 CTGTTGTTACTGAAGATGAAAGG - Intronic
1076496490 10:130900880-130900902 TGGGTCTTCCTGAGGCAGAAGGG - Intergenic
1076699564 10:132264449-132264471 CTGGGGACCTTGAGGAAGAAAGG + Intronic
1078436996 11:11333671-11333693 CTGATGCTCCTGAGAAAGGAGGG - Intronic
1082249673 11:49964301-49964323 CTGGTGATACTGAGGAAAACAGG + Intergenic
1083009323 11:59381218-59381240 TTGGTATTCCTGAGGAAAAAAGG - Intergenic
1083889714 11:65589737-65589759 CTGGCCTTCCTGTGGAAGAAGGG - Exonic
1084372997 11:68756829-68756851 CTGGTGTTTCTGAGGGGGAGGGG + Exonic
1084507240 11:69575918-69575940 CAGGTATTCCAGAGGTAGAAAGG + Intergenic
1084767221 11:71320442-71320464 CTAGTGGCCCTGAGGCAGAAAGG + Intergenic
1086222331 11:84463333-84463355 CTGATATTCCTGAGGAGGATGGG - Intronic
1088002501 11:104899337-104899359 CAGGTGTTCAAGAGGAAGAAGGG - Intergenic
1088083164 11:105945112-105945134 CTGGAGTTCCTTAGGAAGAAGGG - Intronic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1089256631 11:117197691-117197713 CTGCTGTTCCTGGGGAGGTAAGG - Intergenic
1089776957 11:120844526-120844548 CTGGAGTTCTTGGGGTAGAAGGG + Intronic
1090731910 11:129579758-129579780 ATGGAATTCCTCAGGAAGAAAGG - Intergenic
1092167581 12:6352381-6352403 CTGGAGATCTTTAGGAAGAAGGG + Intronic
1093396023 12:18683587-18683609 CAGGTCTTCCTGAAGCAGAAGGG - Intronic
1094180177 12:27584239-27584261 CTGGTGTTCCTGAGGTAATGAGG - Intronic
1094687913 12:32737091-32737113 CTTGTGTTTCTTAGGAACAAAGG + Exonic
1095178584 12:39121658-39121680 TTGGTGTTCCCAAGGAAGAAGGG - Intergenic
1096478815 12:51924557-51924579 CTGGGGTCCCTGAGGAAGTCAGG - Intergenic
1096776121 12:53965462-53965484 CAGGTGTTCCTGGGGGAGAGGGG - Intergenic
1096882949 12:54687401-54687423 TTTTTGTCCCTGAGGAAGAAGGG + Intergenic
1097088320 12:56486192-56486214 CTGGTGCTCCCCAGGCAGAAAGG - Intronic
1097957463 12:65500952-65500974 CTGGTGGTCAGGAGGAGGAAAGG - Intergenic
1097967075 12:65592729-65592751 CTAGTGTTCCTTAAGAAGAAAGG - Intergenic
1099732580 12:86524683-86524705 TTGGTGTCCCTGAAAAAGAAGGG - Intronic
1099832650 12:87865046-87865068 TTGTTGTTTCTGAGGAAGAAAGG - Intergenic
1100390306 12:94141417-94141439 CTGGTGTCACTGAGGACGGAAGG + Intergenic
1101653900 12:106702934-106702956 CAGGTGTTCATGAGGAAGACTGG - Intronic
1102836908 12:116072300-116072322 CTGGTTTTCTTGATGAACAATGG + Intronic
1103322543 12:120100403-120100425 GGGGTGGTCATGAGGAAGAAAGG + Intronic
1103847004 12:123908630-123908652 CTGGTTCTCCAGAGGAACAAGGG + Intronic
1104779205 12:131408944-131408966 CTTGTGTCCCAGAGGGAGAAGGG + Intergenic
1106425651 13:29626293-29626315 CTGGTGTTCCTGAAAGGGAAGGG + Intergenic
1107528870 13:41262601-41262623 ATGGTCTTACTGAGTAAGAAAGG + Intronic
1107701908 13:43057218-43057240 CTGGTGTCCCCGACAAAGAAGGG - Intronic
1108451804 13:50574752-50574774 CTTCTCTGCCTGAGGAAGAAAGG - Intronic
1109201207 13:59433805-59433827 TTGGTGTTACCAAGGAAGAAGGG - Intergenic
1110238463 13:73241115-73241137 CTGGTCTTCCTTATGATGAATGG + Intergenic
1110375843 13:74793206-74793228 TTGGTGTTCCTGAGGGAGAAGGG - Intergenic
1111132906 13:83999586-83999608 CTGGGGTACATGAGGGAGAAAGG - Intergenic
1111541000 13:89667199-89667221 CTGGAGTACCTGATGGAGAATGG - Intergenic
1111741194 13:92207548-92207570 CTGATCCTCCAGAGGAAGAAAGG + Intronic
1112077519 13:95929919-95929941 CTGGTGAGGCTGAGGAGGAAGGG - Intronic
1112704451 13:102050945-102050967 CTGGTGTTCCCCATCAAGAATGG - Intronic
1114491434 14:23104669-23104691 CTTGGGATCCTGAGGGAGAAGGG - Intergenic
1116631207 14:47336303-47336325 CTAGTAATTCTGAGGAAGAATGG + Intronic
1117240844 14:53830721-53830743 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1117638903 14:57776173-57776195 CTGGTGTTCCTGAAAGAGATGGG + Intronic
1119220291 14:72900972-72900994 CTGGTGTTAGTGAGGGAGAAGGG - Intergenic
1120450786 14:84664844-84664866 CTGGTGTTCCTGAGCAGGTAGGG - Intergenic
1121509655 14:94502880-94502902 CTGGGGTTCCTGGGGCAGGAAGG - Intronic
1123577941 15:21691559-21691581 CTGGTGTCCCTGAAGGAGATGGG + Intergenic
1123614566 15:22134041-22134063 CTGGTGTCCCTGAAGGAGATGGG + Intergenic
1123911255 15:24969780-24969802 CTAGTATTCCTGTAGAAGAAGGG + Intronic
1124562433 15:30787580-30787602 CTGGTTTCCCTGAAGAGGAAGGG + Intergenic
1124941942 15:34226373-34226395 CTGGTGAGCCTGATGAAGAAAGG - Intronic
1126279217 15:46923415-46923437 CTAGTGTACCAGAGGAAGACAGG + Intergenic
1126284429 15:46995417-46995439 CTGGAGTACCTGAAGAAGATGGG - Intergenic
1126678545 15:51182773-51182795 CTTTTGTTGGTGAGGAAGAAAGG + Intergenic
1127090137 15:55458568-55458590 TTGGTGCTCCTGAGGAAGAAGGG + Intronic
1127573828 15:60271287-60271309 TTAGTGTTCCTGAGAAAGAAGGG - Intergenic
1127866251 15:63035601-63035623 CTGAAGTTCCTGAGGTAGAATGG + Intergenic
1128383102 15:67127641-67127663 CTGGAGTTCCTGAAGATGAAGGG + Intronic
1128618869 15:69132148-69132170 CTGTTTTTCATGAAGAAGAAGGG - Intergenic
1129022927 15:72539771-72539793 CTGTTGTTACTGAGGAAGTCTGG - Intronic
1129269096 15:74410148-74410170 CTGGTGTTCCTGAAGACCCAGGG - Exonic
1129866042 15:78909597-78909619 CTGGTGAACCTGAGCAATAAAGG + Intergenic
1129948086 15:79559670-79559692 CTGGTGTTGATGATGATGAAGGG + Intergenic
1130424159 15:83778145-83778167 CTGGTGTCCCTGAAAAAGAGGGG + Intronic
1130891490 15:88137412-88137434 CTGATGTTCATGCGGAAGAGAGG + Exonic
1131057441 15:89383974-89383996 CTGGAGTTTCTGAGGGGGAAAGG - Intergenic
1131443571 15:92476969-92476991 CTGGTGTTTCTGGGGGAGGATGG + Intronic
1131456337 15:92585297-92585319 CTCGTATTCTTGAGGGAGAAGGG - Intergenic
1131531737 15:93199592-93199614 CTGGTGTTTCTCAGTAAGAAAGG + Intergenic
1131638507 15:94263572-94263594 CTGGTGTTCCTAAGGACAGAAGG - Intronic
1132109117 15:99089294-99089316 TTGGTGTTGCTGTGGAATAAAGG - Intergenic
1132412726 15:101596646-101596668 TTGGTGTTCCAGAGGAAGAAGGG - Intergenic
1202986811 15_KI270727v1_random:425804-425826 CTGGTGTCCCTGAAGGAGATGGG + Intergenic
1134132267 16:11657791-11657813 CTGGAGTCCCTGAGTGAGAAAGG - Intergenic
1137552815 16:49452296-49452318 CTGGGCTTCCTGAGGATGCAGGG + Intergenic
1138843493 16:60537887-60537909 CTGGTGTTCCTGAAGGGGACAGG - Intergenic
1139447313 16:67005881-67005903 CTGTTCTTCCTTAGGAACAAGGG + Intronic
1139538072 16:67591687-67591709 CAGTTTTTCCTGAGGATGAAAGG - Intronic
1139547932 16:67658354-67658376 CCGGGGTTCCTGAGGAGGAGGGG + Exonic
1141458285 16:84159446-84159468 CTGAAGTTCATGTGGAAGAAAGG + Intronic
1142985337 17:3691771-3691793 TGGGTGTTCCTGATAAAGAAGGG - Exonic
1143840973 17:9731471-9731493 CTGAGCTTCCAGAGGAAGAATGG - Intergenic
1144218486 17:13078967-13078989 CTGTTTTTCAAGAGGAAGAAAGG - Intergenic
1145090018 17:19978275-19978297 CGGGTTCTCCTGAGGAAGCAGGG - Intronic
1146017631 17:29246756-29246778 CTGGGGATCATGAGGAACAAAGG + Intergenic
1147720820 17:42538325-42538347 CAGGTACACCTGAGGAAGAAGGG - Exonic
1147987873 17:44316558-44316580 CGGGTCGTCCTGGGGAAGAAGGG + Intronic
1148877966 17:50703637-50703659 CTGGTATTCCAGAGAAAGCAAGG + Intronic
1149089919 17:52765149-52765171 TGGTTGTTCCTGAGGGAGAAGGG + Intergenic
1150837575 17:68578484-68578506 CTGGTCATGCTGAGGAGGAAAGG - Intronic
1153668785 18:7391031-7391053 GTGGTTTCCCTGAGAAAGAATGG + Intergenic
1154342928 18:13519338-13519360 CTGGTGTTCCGGAGGGAGCCGGG + Intronic
1155001801 18:21694968-21694990 GTTCTGTTGCTGAGGAAGAAGGG - Intronic
1157541003 18:48506571-48506593 TTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1158377377 18:56886009-56886031 TTGGTGTTCCTGAGAAAGAAGGG + Intronic
1159332448 18:67015385-67015407 GTGGGATCCCTGAGGAAGAAAGG - Intergenic
1159606918 18:70484380-70484402 CTGGTGTCCCTGAAAAGGAAGGG - Intergenic
1159724754 18:71942774-71942796 GTAGTGTTCCTCAGGAGGAAAGG - Intergenic
1160058968 18:75512210-75512232 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1160397940 18:78585504-78585526 CTGGTTTTCATGATAAAGAAAGG + Intergenic
1162593182 19:11606552-11606574 CTGGGGTTCTTGAGGACGGATGG + Intronic
1164541890 19:29127674-29127696 CTAGATTTCCTGAGGCAGAAAGG + Intergenic
1165082925 19:33320566-33320588 TTGGTATTACTGAGGAGGAATGG + Intergenic
1165462848 19:35954222-35954244 CTTCTGTGCCTGAGGAAGGAGGG - Intergenic
1167305775 19:48708503-48708525 CTGGTTTTCCTGAGGCAGGAGGG + Intergenic
1202677357 1_KI270711v1_random:19854-19876 CAGGAGTTCCTGGGTAAGAACGG - Intergenic
925591405 2:5513411-5513433 CAGCTTTTCCTGAGGAAGAAGGG + Intergenic
925636995 2:5950115-5950137 CTGATTTTCCTGCAGAAGAAGGG - Intergenic
926198134 2:10775820-10775842 CTGGTGGGCATGAGGAAGAAGGG - Intronic
926427101 2:12748060-12748082 CTAGTGCTCCTGTGGAATAATGG + Intergenic
928360462 2:30658442-30658464 CTGGCGTTCCTGACTAATAAAGG + Intergenic
929170821 2:38931610-38931632 CTGGTTTTCCAGAGAAAGACAGG - Intronic
929551386 2:42895323-42895345 CTGGTGTCCCTGAGTCAGAAGGG - Intergenic
933477067 2:82804390-82804412 CTGGTGTACCTGAAGGAGATGGG + Intergenic
933994504 2:87658022-87658044 CTGGTGTTCCTGAGAGTGACTGG - Intergenic
935345921 2:102108371-102108393 CTGGTTTTCCTGTACAAGAATGG - Intronic
935431155 2:102977353-102977375 CTGGTTTCACTGAGAAAGAATGG - Intergenic
936299354 2:111292891-111292913 CTGGTGTTCCTGAGAGTGACTGG + Intergenic
936724445 2:115296101-115296123 CTGGTGAGCCTTAGGAAAAATGG + Intronic
937210011 2:120262428-120262450 CTGGTGTGCCTGAGGTTGCAGGG + Intronic
938154469 2:128920883-128920905 GTGGTGTTTCTGAGGAGGAATGG + Intergenic
938773464 2:134520970-134520992 CAGGTGTTCCTTATGAAGCAAGG + Intronic
942789595 2:179744838-179744860 CTGGTGTTTCTAAGCATGAATGG - Intronic
944348332 2:198696120-198696142 CTTGTGTACCAGAGGATGAAAGG - Intergenic
945952123 2:216049257-216049279 TTGGTGTTCCTGAGGAGGTAAGG - Exonic
946585000 2:221176055-221176077 TTAGTGTTCCCTAGGAAGAATGG + Intergenic
947011261 2:225569517-225569539 CTTGTGTTCCTGTTGAAGCATGG - Intronic
947916555 2:233835956-233835978 ATGGTTTTCCTGAAGAGGAAAGG + Intronic
948917461 2:241042129-241042151 ATGGTGCTCCTGAGGCAGGAGGG + Intronic
1168910857 20:1445567-1445589 CTGGTATTTAGGAGGAAGAACGG + Intronic
1170201295 20:13747056-13747078 CTGGTGGGCCTAAGGATGAAAGG + Intronic
1171815609 20:29783554-29783576 CCTGTGTCCCTGAGGGAGAAGGG - Intergenic
1172779697 20:37428893-37428915 CTGGTGTCCCAGAGGAATGATGG - Intergenic
1172840462 20:37900165-37900187 CTGGTGGTTCTGAGGATTAAGGG + Intergenic
1173812273 20:45963390-45963412 CTGGTGCCACTGAGGGAGAATGG - Intronic
1173819194 20:46009852-46009874 CAGGTATTCCTGTGGATGAAGGG - Exonic
1174590760 20:51642854-51642876 CAGGGGTTCCAGAGAAAGAAAGG - Intronic
1175691541 20:61069020-61069042 GCGGTGTTCCTGGGGAAGGATGG + Intergenic
1176197632 20:63844682-63844704 CAGGTTTTCCTGAGGAAGGAAGG + Intergenic
1176308101 21:5134910-5134932 CTGTTGTCCCTGAGGATGGATGG - Intronic
1176365549 21:6030505-6030527 CAGGTGTTCATCAGGAACAAGGG + Intergenic
1177805389 21:25869955-25869977 CTGGTGTTCTGAAGGATGAATGG + Intergenic
1178619598 21:34161989-34162011 CTGGGGTACTTGAGGGAGAAGGG + Intergenic
1178855940 21:36250477-36250499 CTGGGGTTCCTGAGGCGGCATGG + Intronic
1179139794 21:38714743-38714765 CTGGTGTTTCTGAGGTTGGAAGG + Intergenic
1179757969 21:43508040-43508062 CAGGTGTTCATCAGGAACAAGGG - Intergenic
1179848959 21:44127122-44127144 CTGTTGTCCCTGAGGATGGATGG + Intronic
1181001634 22:19990456-19990478 CTGGGGCTCCTGGGGAGGAAAGG - Intronic
1182480484 22:30605683-30605705 CTGGAGGTTCTGAGGAAGGAGGG - Intronic
1183002383 22:34872141-34872163 CTGGGCTTTCTGGGGAAGAAAGG - Intergenic
1183602501 22:38848118-38848140 CAGGTGTCCCTAAGGAAGAGAGG - Intergenic
1184311756 22:43650105-43650127 CTTGTGGTCCTGAGGAAATAAGG + Intronic
1184502086 22:44880397-44880419 CTGGTGTTCCAGAGGTGCAAAGG + Intergenic
1184542329 22:45134789-45134811 ATTCTGTTCCTGTGGAAGAAGGG + Intergenic
949733313 3:7140706-7140728 CTGGATATCCTGAGGAAGTACGG + Intronic
949843301 3:8343546-8343568 CTGGTGTTCTGGAAGAAAAATGG + Intergenic
950131593 3:10550940-10550962 CTGCTGTTCCTGTGGCTGAATGG + Intronic
953680798 3:45036549-45036571 CGGGATGTCCTGAGGAAGAAGGG - Intergenic
953822192 3:46216369-46216391 TTGGTGTGCCTGAGGAAGAAAGG + Intronic
953981410 3:47414985-47415007 CTGGGGTCCCTGAGGACAAAAGG + Exonic
955117273 3:56018056-56018078 GTGGTGTTCCTGAGACATAACGG + Intronic
955793698 3:62613383-62613405 CAGGTGTTTATGAGGAAGAAGGG + Intronic
955861157 3:63332166-63332188 CTGAAGTTTCTGAGGCAGAAAGG - Intronic
955895450 3:63694763-63694785 CTGGTGATACTGAGGCAAAAAGG + Intergenic
955976914 3:64488756-64488778 CTGCTTTTACAGAGGAAGAAAGG - Intergenic
959047274 3:101488454-101488476 CTGGCATTCCTGAGAAAGAATGG + Intronic
959275086 3:104268590-104268612 TCAGTGTTCCTGAGGAGGAAGGG - Intergenic
959526036 3:107378426-107378448 CTGGGGTTCCTCAGGAAGAATGG - Exonic
960096098 3:113691281-113691303 CTGGTGGTTGGGAGGAAGAATGG - Intronic
961424842 3:126836908-126836930 CTGCTCTTCCTGAGGAGAAATGG + Intronic
962243746 3:133773880-133773902 CTGGTGTTTCTAAGGGAGAGAGG - Intronic
962343594 3:134604369-134604391 CTGCTGAGCCTAAGGAAGAATGG - Exonic
962826868 3:139106710-139106732 ATGGTGCTCCAGAGGAAGAATGG + Intronic
963317637 3:143777096-143777118 CTGGTATTTCTGAGAGAGAATGG - Intronic
964447580 3:156776325-156776347 CTTGTGTTTCTGAGGAAGGTGGG + Intergenic
964966712 3:162503220-162503242 CTGGTGTTCATCAGGAATATTGG - Intergenic
965101709 3:164307068-164307090 TTTGTGTTCCCAAGGAAGAAGGG + Intergenic
965154167 3:165025377-165025399 CTGGTGTTCCTGAGGAAGAAGGG + Intronic
966131890 3:176650760-176650782 CTGGAGTCACTGAGCAAGAATGG - Intergenic
966840509 3:184083628-184083650 CTGGGGCTCCTGAGGCAGAAGGG + Intergenic
967120252 3:186376340-186376362 ATGGTGATCCTGGGGAAGAAGGG + Intergenic
967154722 3:186681896-186681918 CTGGAGTCCCTGGAGAAGAAGGG - Intergenic
967894032 3:194382777-194382799 CAGGAATTCCTCAGGAAGAAAGG + Intergenic
969341803 4:6546810-6546832 CTGGTGGTCCTTATGAAAAAGGG + Intronic
969784269 4:9441653-9441675 ATGGTTTTCCTGAGGGGGAAAGG + Intergenic
970225456 4:13852234-13852256 CTTTTGTTCCTGCGGATGAAAGG + Intergenic
971535247 4:27739509-27739531 CTAGTCTTGCAGAGGAAGAAAGG - Intergenic
971573243 4:28241014-28241036 TTGTTGTTTCTGAGGAGGAATGG + Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972278874 4:37584539-37584561 GTGGTTTTCCTGGGGAAGGAGGG + Intronic
973804436 4:54512197-54512219 TTGGTGTTCAGGAGGAAAAAAGG + Intergenic
974529206 4:63085280-63085302 CTGACATTCCTGAGGAAGAAGGG - Intergenic
974683554 4:65195259-65195281 CTGAGGGTGCTGAGGAAGAAGGG + Intergenic
975321663 4:73015416-73015438 CTGGTGTTCTGGAGGAAGAGTGG - Intergenic
976350195 4:84051982-84052004 CCGTTGTTCCTTAGGAAAAAAGG + Intergenic
976962973 4:91002365-91002387 CTGGTATTCCTGAGGAAGAAGGG - Intronic
978972229 4:114822500-114822522 CTGGAATTCCTGAGGAAGGTTGG + Intergenic
979159880 4:117446934-117446956 TTGGTGTTCCTGAGAAAGAAGGG - Intergenic
981657554 4:147129273-147129295 CTTGTGTTCCTTCTGAAGAAAGG + Intergenic
982253660 4:153432165-153432187 CTGGGGGTGCTGAGGAAGGAGGG + Intergenic
984592992 4:181637146-181637168 TAGGAGTTGCTGAGGAAGAAGGG - Intergenic
984706829 4:182853430-182853452 GTGGTGAACCAGAGGAAGAAAGG + Intergenic
984717126 4:182936304-182936326 CTGGAACTCCTGAGGAAGTATGG - Intergenic
985019127 4:185669110-185669132 CTGGAGCTCCTGAGGAATGAAGG + Intronic
987851409 5:23360674-23360696 CTGTTGATCCCAAGGAAGAATGG - Intergenic
987862879 5:23508194-23508216 TTGGGGTTCCTCAGGATGAAAGG - Intronic
987994529 5:25258660-25258682 CTGGTGTTAGGGAGGGAGAAAGG + Intergenic
988237675 5:28566528-28566550 CTGGTGTGAGTGTGGAAGAAGGG + Intergenic
988652240 5:33165715-33165737 TTGGTGTTCCCAAGGAAGATGGG - Intergenic
988964128 5:36399332-36399354 ATGGTGTTCCTGGGCAAGCAAGG + Intergenic
988970290 5:36460057-36460079 TTGGTGTGGCTGAGGAAGAAAGG + Intergenic
989231939 5:39096737-39096759 CTGGTTTTCCCTAGGAAGGAGGG + Intergenic
989493992 5:42090188-42090210 CTGGAGTGACTGAGGAAGAATGG - Intergenic
992459204 5:76944351-76944373 CTGGTGCTCTGGAGGAAGATGGG + Intergenic
994597847 5:101861737-101861759 CTGGTGTCCCTGAAAAAGACAGG + Intergenic
996427345 5:123329258-123329280 TTGGTGTTCCTGAGGAAGAAGGG - Intergenic
996537438 5:124593153-124593175 CTGGGGCTCCTGGGGTAGAAGGG + Intergenic
996582148 5:125043257-125043279 CTGATGTTCCATGGGAAGAATGG + Intergenic
999232580 5:150070294-150070316 CTGGGGGGTCTGAGGAAGAAAGG + Exonic
1000339878 5:160268864-160268886 CTTGATTTCCTGAGGGAGAAAGG - Intronic
1001217574 5:169870062-169870084 TTGGTCTTCCTGAGGATGCATGG + Intronic
1001573096 5:172743682-172743704 CAGGTGGTCCAGAGGAAGGAGGG + Intergenic
1001980283 5:176033555-176033577 CTGGGCCTCCTGTGGAAGAAGGG - Intronic
1001980296 5:176033622-176033644 CTGGGCCTCCTGTGGAAGAAGGG - Intronic
1001980309 5:176033689-176033711 CTGGGCCTCCTGTGGAAGAAGGG - Intronic
1001980322 5:176033756-176033778 CTGGGCCTCCTGTGGAAGAAGGG - Intronic
1001980335 5:176033823-176033845 CTGGGCCTCCTGTGGAAGAAGGG - Intronic
1001980348 5:176033890-176033912 CTGGGCCTCCTGTGGAAGAAGGG - Intronic
1002806214 6:576874-576896 CTGGGTTACCTGGGGAAGAAAGG + Exonic
1003247388 6:4394928-4394950 CGGGTGGTACTGAGGGAGAAAGG + Intergenic
1003638738 6:7858680-7858702 CTGGCTGTCCTGAGGAATAAAGG + Intronic
1004282349 6:14291736-14291758 CTGAGGTTCCTGAGGATGGATGG + Intergenic
1004599513 6:17134070-17134092 CTGGTATTCCTGAGAGAAAAAGG + Intergenic
1005676926 6:28164385-28164407 CTGGGGAAACTGAGGAAGAAGGG - Intergenic
1006152367 6:31996369-31996391 CCTGGGTTCCTGAGGAAAAAGGG - Intronic
1006158668 6:32029107-32029129 CCTGGGTTCCTGAGGAAAAAGGG - Intronic
1006252981 6:32806280-32806302 TTGGTGTTCCTGAGAGAGATGGG - Intergenic
1006441277 6:34055239-34055261 CTGGTGTTCCTGAGAGAGAAGGG - Intronic
1007478342 6:42133999-42134021 CAGGTTCTCCTGAGGGAGAAGGG - Intronic
1008449254 6:51631321-51631343 CTTGTCTTTCTGAAGAAGAAGGG - Intronic
1009392106 6:63156666-63156688 TTGGTGTTCCTGAAAAAGAAGGG + Intergenic
1009891359 6:69687292-69687314 CTGGTGTTCAGAAGGAGGAATGG - Intronic
1012944242 6:105449036-105449058 CTATGGTTCCTGAGAAAGAAGGG + Intergenic
1014112280 6:117632139-117632161 ATGGTGTAGCTAAGGAAGAAAGG + Intergenic
1016176069 6:141078881-141078903 TTGGTGTTCCTGAGGAATAATGG + Intergenic
1016351616 6:143175417-143175439 TTGGTGTTCCTGAAGAAGAAGGG - Intronic
1017191964 6:151663818-151663840 CTGTTGTTCCTGAGAGTGAAGGG + Intronic
1017790469 6:157793678-157793700 CTGGGGTTGCTGAGGCAGGATGG - Intronic
1018053598 6:160032736-160032758 CTGGCGCTGCTTAGGAAGAAGGG + Intronic
1018060004 6:160082823-160082845 CAGGTGCTCCTGAGGCAGCATGG + Intronic
1018533240 6:164790315-164790337 CTGGGGAGCCTGAGGAACAAAGG - Intergenic
1019660032 7:2219128-2219150 CTGATGTTCCTGGAGCAGAATGG - Intronic
1023691485 7:42793379-42793401 CTAGTCTTCCTGTGGAACAAAGG + Intergenic
1024058174 7:45679493-45679515 CTGGGGTTCCTGAGTAAGAAGGG - Intronic
1024367163 7:48534619-48534641 TTGGTTTTCCTGAGGAAGAAGGG - Intronic
1025638858 7:63349284-63349306 CTGCAGATCCTGAGGAAGGAGGG - Intergenic
1025643841 7:63398808-63398830 CTGCAGATCCTGAGGAAGGAGGG + Intergenic
1027221737 7:76218438-76218460 CTGGGGCTGCTGAGCAAGAATGG - Intronic
1028294120 7:89106003-89106025 GTGTTGTACCTGAGGAAGCATGG - Intronic
1030936133 7:115586405-115586427 TCCATGTTCCTGAGGAAGAAGGG + Intergenic
1031297147 7:120015057-120015079 CTGTTCTTTCTGAGGAAGTAGGG - Intergenic
1031604927 7:123757363-123757385 TTGGAGATCCTGAGGAAGATTGG - Intergenic
1032801942 7:135323965-135323987 CTGCTGTTCCTCAGGAAAGAAGG + Intergenic
1033432312 7:141300369-141300391 ATGGTAGTCCTCAGGAAGAAAGG + Intronic
1034963345 7:155375577-155375599 CTGGAGCTCCAGAGAAAGAAGGG + Intergenic
1035914833 8:3607822-3607844 CTGGTGTTGGTGTGGCAGAAAGG + Intronic
1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG + Intronic
1036815164 8:11896970-11896992 CCGGTGTGGCTGAGGAAGACTGG - Intergenic
1037827683 8:22168850-22168872 GTGGGGTTCCCCAGGAAGAAGGG + Intronic
1039154224 8:34536931-34536953 CTGGTGTGCCTGAGAGAGATGGG + Intergenic
1040573056 8:48626590-48626612 GTGGGGTATCTGAGGAAGAAGGG + Intergenic
1040882482 8:52221785-52221807 CTGTAGTTCCTGGGGAAAAATGG + Exonic
1043413501 8:80024795-80024817 CTGTAGTTCCTGAAGAACAAGGG - Intronic
1043541787 8:81271650-81271672 ATGGTTTTCTTGAGGAACAAGGG + Intergenic
1043963122 8:86440705-86440727 CTGATGTTCCTGAAGAAAAATGG - Intronic
1048303084 8:133265680-133265702 TTTGTTTTCCAGAGGAAGAAAGG - Intronic
1048339359 8:133526809-133526831 CTGTTGTTCCTGGGGCAGAGTGG + Intronic
1048613235 8:136047075-136047097 CAGGTCTTCCTGAGCAAGAGGGG + Intergenic
1049032157 8:140046076-140046098 CAGGTGTTCCTCAGGGAGAAGGG - Intronic
1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG + Intronic
1050401593 9:5261953-5261975 CTGGGGTTCGTGAGGAAAACAGG + Intergenic
1051351442 9:16201508-16201530 ATGTTGTTCCTGATGAAAAAAGG - Intergenic
1052277356 9:26692220-26692242 TTGGCTTTCCTGGGGAAGAAAGG + Intergenic
1053064980 9:35061827-35061849 CTGGTTTTCCTGAGACTGAAAGG - Intronic
1053231609 9:36415156-36415178 TTGGTGTTGTTGAGGAAGAAGGG - Intronic
1055834129 9:80419096-80419118 CTGGGGTTCCGGGGGAAGAGGGG + Intergenic
1055905662 9:81291389-81291411 TTGGTGTACCTGAGGAAGAAGGG - Intergenic
1057416171 9:94863998-94864020 TTGGGGGTACTGAGGAAGAAGGG + Intronic
1058990682 9:110253257-110253279 ATGGTGTTCCTGAGAAAGGTAGG + Intronic
1061239528 9:129361538-129361560 CTGGAGATCCTGGGGAAGTATGG - Intergenic
1061676756 9:132221644-132221666 CTCCTGTTCCCGAGGAAGACAGG + Intronic
1203367281 Un_KI270442v1:269870-269892 CCTGTGTCCCTGAGGGAGAAGGG - Intergenic
1189603287 X:42649634-42649656 TCGGTGTTCCTGAGGAAGAAGGG + Intergenic
1190537100 X:51440356-51440378 TTGGTGTTCCTGTGGAAGGGAGG - Intergenic
1190636674 X:52441602-52441624 CTGGCATTCATGAGGAAGACTGG + Intergenic
1191914474 X:66186837-66186859 TTGGTATTCCTAAGGAAGAAGGG - Intronic
1192207048 X:69103231-69103253 CTGGTGAACCTGGGGGAGAAGGG - Intergenic
1192345599 X:70301696-70301718 CTGAAGTTCCTAAGGAAGATTGG + Intronic
1193446770 X:81615397-81615419 TTGATGTTCCTGAGGAAGAAGGG - Intergenic
1193960259 X:87915911-87915933 CTGGTGTCCCTGAAAAAGATGGG + Intergenic
1194103471 X:89737451-89737473 CCAGTGTTCCTAAAGAAGAAAGG - Intergenic
1194144181 X:90243277-90243299 TTGGCGTTCCTAAGGGAGAAGGG + Intergenic
1195432311 X:104803082-104803104 CTGCTGTTGGGGAGGAAGAAAGG + Intronic
1195933261 X:110100952-110100974 CTGTTGTTCATGAGGAATATTGG + Intronic
1196040663 X:111199854-111199876 CTGTTGATCATGAGGAGGAAAGG + Intronic
1196161456 X:112488515-112488537 TTGTTGTTCCTGAGGAAGAAGGG + Intergenic
1197049739 X:122043996-122044018 CTGGTGTTCCTGAAGGAGAAGGG - Intergenic
1198392793 X:136193380-136193402 GTGGTGTTTCTGAGGTAGAGAGG + Intronic
1198731288 X:139732492-139732514 CAGATGTTCCTGAGGAAGGGAGG + Intronic
1199654209 X:149978746-149978768 CTGATGTTCCAGAGGAGGGAGGG - Intergenic
1199964850 X:152811372-152811394 CTGGGGTTCCCGTGGCAGAAAGG + Intergenic
1200489946 Y:3812585-3812607 TTGGTGTTCCTAAGGGAGAAGGG + Intergenic
1201349669 Y:13025849-13025871 CTGGAGTTCCAGAGGAAGGAAGG - Intergenic