ID: 965157475

View in Genome Browser
Species Human (GRCh38)
Location 3:165082660-165082682
Sequence CTGGAAATGCAGAGAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965157473_965157475 6 Left 965157473 3:165082631-165082653 CCATAATTGCTTCAATTGGTCAT No data
Right 965157475 3:165082660-165082682 CTGGAAATGCAGAGAGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965157475 Original CRISPR CTGGAAATGCAGAGAGAGCC AGG Intergenic
No off target data available for this crispr