ID: 965165581

View in Genome Browser
Species Human (GRCh38)
Location 3:165191971-165191993
Sequence TTTCATATACTGATGTTATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 405}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965165581 Original CRISPR TTTCATATACTGATGTTATT AGG (reversed) Intronic
900790064 1:4674087-4674109 TTTCAAATACAAATGTTACTGGG + Intronic
901256928 1:7837170-7837192 TGTCATATACTCATGTATTTTGG + Intronic
902626945 1:17682346-17682368 TGAGATACACTGATGTTATTGGG - Intronic
903717870 1:25382190-25382212 ATTCATATGTTGATGCTATTTGG - Intronic
905611219 1:39353459-39353481 TTTCAAATACTGATGTTTCCAGG + Intronic
906003478 1:42447480-42447502 TTTGCTATAAAGATGTTATTGGG + Intronic
907066398 1:51488175-51488197 TTTTATATACTGATCACATTTGG - Intronic
907656699 1:56350423-56350445 TTACATATATTGATATTGTTGGG + Intergenic
909995370 1:82272452-82272474 TTTTCTATATCGATGTTATTTGG - Intergenic
910171637 1:84384019-84384041 GTTCATATACAGTGGTTATTAGG - Intronic
912438734 1:109681542-109681564 ATACATATACTCATATTATTAGG - Intronic
912486552 1:110033702-110033724 GTTCATATGTTGATGGTATTTGG - Intronic
913019283 1:114770868-114770890 TTGCTAATACTGATTTTATTTGG + Exonic
913220012 1:116652096-116652118 TTTCTGATACTGATGATATAAGG + Intronic
914836093 1:151208169-151208191 TTTGATATACTGCTTTTAATTGG + Intronic
915714833 1:157935270-157935292 TTTAATTTACATATGTTATTGGG + Intergenic
917156268 1:172002686-172002708 TTTGATATGCTGATTTAATTGGG + Intronic
917708778 1:177662356-177662378 TTTCTTATATTGTTTTTATTTGG - Intergenic
917731062 1:177875499-177875521 TTTTATATGCTAATGTAATTTGG + Intergenic
918755383 1:188335000-188335022 ATACAAATACTGTTGTTATTAGG - Intergenic
918901519 1:190426418-190426440 TTTCAGATATTGGTGTTTTTTGG + Intronic
918998172 1:191790194-191790216 TTTAAAATACTGTTTTTATTGGG - Intergenic
919000331 1:191823673-191823695 TACCTTATACTGATGTCATTTGG - Intergenic
919127665 1:193415878-193415900 TATCATTTAATGATATTATTAGG - Intergenic
919210049 1:194470542-194470564 TTTAATATACTGAAGATTTTTGG + Intergenic
919529447 1:198698488-198698510 TTTCATTTACTGATATAATTGGG + Intronic
921883485 1:220279805-220279827 TTACTTATATTGATGTTCTTAGG - Intergenic
922015958 1:221647195-221647217 ATTCATATGCTGATGGTATTTGG - Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
923047167 1:230363674-230363696 TTGCATATGCTGATATTTTTTGG + Intronic
923377939 1:233384581-233384603 TTTCATGTATTGATGATTTTAGG - Exonic
924127532 1:240870753-240870775 TTTCACAAAATGATTTTATTTGG - Intronic
924263647 1:242257636-242257658 TTTCATATACTTATTTTTTGTGG - Intronic
924360634 1:243238016-243238038 TTTCATATACTGTAATTCTTAGG + Intronic
1064962969 10:20986828-20986850 TTTATTATTCTGATGCTATTTGG - Intronic
1065714800 10:28555689-28555711 ATTCATATATTGATCGTATTTGG + Intronic
1066140977 10:32503975-32503997 TTTTCTTTACTGAGGTTATTTGG + Intronic
1066721151 10:38340837-38340859 TTTCATATACTTATTTTTTGTGG + Intergenic
1068104294 10:52593985-52594007 TTGCAAATACTGATGCAATTAGG + Intergenic
1068366084 10:56051925-56051947 TTTCAAAATGTGATGTTATTGGG - Intergenic
1068607121 10:59017998-59018020 TTCCATATACTGATTCTTTTGGG + Intergenic
1069265336 10:66450431-66450453 TTTACTATACTGATGTTAAGGGG + Intronic
1070187323 10:74077264-74077286 TTTTTTATTCTGATGTCATTAGG - Intronic
1070223166 10:74472301-74472323 TTTCATATACAGTCTTTATTGGG + Intronic
1070460164 10:76658974-76658996 TTTCAACTACATATGTTATTTGG + Intergenic
1074964257 10:118474709-118474731 TTTCATTCACTGTTGTTTTTTGG - Intergenic
1075133536 10:119762019-119762041 TTTCATATACGGAGGTTCTACGG - Intronic
1076259219 10:129052415-129052437 GTTCATATGCTGATGTGATCAGG + Intergenic
1078497718 11:11836661-11836683 TTTCATATACTTATCTTCTTTGG - Intergenic
1078607267 11:12787774-12787796 TTTCATAAAATTATGTTTTTTGG + Intronic
1079197014 11:18337501-18337523 TTTCATATACAGAAGTAAATGGG - Intronic
1079697231 11:23496651-23496673 CTTCATTTACTGATTTTAATGGG + Intergenic
1080077748 11:28171639-28171661 CTAAATATAGTGATGTTATTGGG + Intronic
1080358583 11:31484395-31484417 TTTCACATACCATTGTTATTTGG - Intronic
1081186555 11:40049865-40049887 TCTCATACACTGATCTTATAAGG - Intergenic
1081610709 11:44561587-44561609 ATTCATATGTTGATGGTATTTGG + Intergenic
1081829909 11:46100609-46100631 TTTAATGTTATGATGTTATTTGG - Intronic
1082867354 11:57912100-57912122 TTCCATAAGGTGATGTTATTAGG + Intergenic
1083069047 11:59957644-59957666 TTTAATATACTGTTGATATCAGG + Intergenic
1085669973 11:78454233-78454255 TTTCATAGACTGATATGGTTTGG + Intronic
1085720888 11:78911572-78911594 ATTCATATATTGATGGCATTTGG + Intronic
1086500892 11:87452536-87452558 TTTCATATATTTAAATTATTAGG + Intergenic
1086508954 11:87534983-87535005 TTTCATATATTTAAATTATTAGG + Intergenic
1087362887 11:97182978-97183000 TTTTATATACTGATTTTCTTAGG + Intergenic
1088324630 11:108589148-108589170 TTTCATAGACTGAAGCCATTTGG + Intronic
1088873580 11:113913833-113913855 ATTCATATGTTGATGGTATTTGG + Intronic
1092277986 12:7076676-7076698 TTCCCTCTGCTGATGTTATTGGG + Intergenic
1092494108 12:8974742-8974764 TTTAATGTGCTGTTGTTATTTGG + Intronic
1093109413 12:15131541-15131563 TTTCCTACACTTATGTTACTAGG + Intronic
1094796694 12:33981770-33981792 TTTCATATATTCATTTTTTTCGG - Intergenic
1095109252 12:38273746-38273768 TTTCATATATTCATTTTTTTTGG - Intergenic
1095555401 12:43497676-43497698 TTGCTTTTACTGACGTTATTAGG - Intronic
1098012572 12:66070752-66070774 ATTCATATGTTGATGGTATTTGG + Intergenic
1099082417 12:78202228-78202250 TTTCATAAAATGATTTTTTTTGG - Intronic
1100513703 12:95304595-95304617 TTTTATATAATGATGTTTCTAGG + Intergenic
1102892193 12:116568601-116568623 GTTCATATGTTGATGGTATTTGG + Intergenic
1103193922 12:119025741-119025763 TCTCATATACGGATTTTACTAGG + Intronic
1104674469 12:130703363-130703385 TTTCAAACACTGATGTTAGATGG - Intronic
1106977866 13:35243924-35243946 ATGTATATTCTGATGTTATTGGG - Intronic
1107102020 13:36603380-36603402 TTTCATATCCTGATATGGTTTGG - Intergenic
1108225877 13:48288192-48288214 TTTCTTATACTGAGGGCATTTGG - Intergenic
1108368835 13:49746772-49746794 TTTCATTTACTGAGGGTACTAGG - Intronic
1108606783 13:52047127-52047149 TTCTAGATACTGATGTTAATAGG + Intronic
1108712795 13:53050356-53050378 TTTCATATGCTAATGTTGCTTGG + Exonic
1108822104 13:54364621-54364643 TTGGATATACTTATTTTATTTGG - Intergenic
1108900825 13:55406009-55406031 TTTAAAATACTTATGTCATTTGG - Intergenic
1108970986 13:56376472-56376494 CTTCAAATCCTGATGTTATTTGG - Intergenic
1109093626 13:58082145-58082167 TTTCACATAATGAAGTTATGGGG - Intergenic
1109124212 13:58499537-58499559 GTTCATGTACAGATGTTAATTGG + Intergenic
1109358087 13:61258537-61258559 TTTCATTTACAGATGCTATTAGG + Intergenic
1109615066 13:64823047-64823069 TTTCATATACTTATAATAATTGG + Intergenic
1109627900 13:65001338-65001360 TCTCATATTCTGAGGTTTTTAGG + Intergenic
1109657893 13:65418660-65418682 TTTCATTTACTTGTGTTGTTTGG - Intergenic
1109987273 13:70004742-70004764 TTTCATATAATAAAGTTATTTGG - Intronic
1110061990 13:71053185-71053207 TTTGATATACTGATTTCCTTTGG + Intergenic
1112277211 13:98032663-98032685 TTCCATATACTGATTTTGTGGGG - Intergenic
1113223995 13:108139153-108139175 TTTCATATACAGATTTTAGAGGG + Intergenic
1114331295 14:21639516-21639538 TTTCATATTCTCTTTTTATTAGG - Intergenic
1114914185 14:27241217-27241239 ATTCATATATTGATGGAATTTGG - Intergenic
1115159904 14:30382051-30382073 ATGCATTCACTGATGTTATTTGG + Intergenic
1115316507 14:32030158-32030180 CTCCATATACCCATGTTATTTGG - Intergenic
1115395403 14:32902822-32902844 TTTCTTGTACTGATGCTCTTTGG + Intergenic
1115535083 14:34365323-34365345 TAAAATATATTGATGTTATTAGG + Intronic
1115578211 14:34731853-34731875 TTTCATATATGGCTTTTATTGGG - Intergenic
1115656020 14:35444486-35444508 ATTCATATGTTGATGGTATTTGG - Intergenic
1116080595 14:40165938-40165960 TTTGATATACTGATTTCTTTTGG - Intergenic
1116698986 14:48213901-48213923 TTTCTTTTACTTTTGTTATTTGG + Intergenic
1117303767 14:54453197-54453219 TTTTATATACTTCTATTATTAGG + Intergenic
1118659665 14:67994865-67994887 ATTCATCTACTGATGACATTTGG - Intronic
1120290924 14:82569827-82569849 TTTTATATACTGATATGGTTTGG + Intergenic
1121371584 14:93363427-93363449 ATGCATATACTGTTGTTGTTGGG + Intronic
1121527765 14:94631576-94631598 TGTCATATATAGAAGTTATTTGG + Intergenic
1121703185 14:95971819-95971841 ATTCATATATTGATGGCATTAGG + Intergenic
1122667441 14:103341860-103341882 ATTAATAAACTGATTTTATTTGG + Exonic
1125231231 15:37458803-37458825 TTTTATAGACTGATGTGATGTGG - Intergenic
1126303069 15:47221500-47221522 TTCCATTTACAGATGTCATTGGG - Intronic
1126842884 15:52734264-52734286 TTTCATATTCTGATTTTCCTAGG - Intergenic
1127011469 15:54635232-54635254 TTCAATATTCTGTTGTTATTTGG - Intergenic
1130928845 15:88405957-88405979 ATTCATATGTTGATGGTATTTGG - Intergenic
1131676176 15:94672968-94672990 CTTCAAATACTGATAGTATTTGG - Intergenic
1131678746 15:94699735-94699757 TTTCCCATACTGTTGTTTTTGGG + Intergenic
1132360309 15:101207352-101207374 TTTAAAATACTGTTGTTAGTTGG - Intronic
1133984229 16:10655912-10655934 TTACTTAAACTGGTGTTATTTGG + Intronic
1134670285 16:16049630-16049652 GTTCCTATACTAAAGTTATTGGG - Intronic
1134892165 16:17850919-17850941 TTTAATAAACTAATGTTATCTGG - Intergenic
1137962330 16:52895135-52895157 ATTCATATGTTGATGGTATTTGG - Intergenic
1138871291 16:60890175-60890197 TATTATATACTGGTGCTATTTGG - Intergenic
1139065596 16:63309845-63309867 TTTTAAAAACTCATGTTATTAGG - Intergenic
1139661376 16:68423342-68423364 ATTCATATATTGATGGCATTTGG + Intronic
1140532664 16:75680163-75680185 TTTGATAAACTGATGTTATCTGG + Intronic
1143798003 17:9353575-9353597 GTAAATATATTGATGTTATTGGG - Intronic
1143981203 17:10871674-10871696 TTTGATATAATAATGTTACTTGG + Intergenic
1144333339 17:14245206-14245228 TTGCATAAACAGATCTTATTAGG - Intergenic
1145802729 17:27700077-27700099 TTTCACAAACTTTTGTTATTGGG - Intergenic
1147915888 17:43885613-43885635 GTAAATATACTGATGTTATTGGG - Intronic
1148916479 17:50984342-50984364 ATTCATATACTTATGCAATTCGG - Intronic
1149027523 17:52045783-52045805 ATGCATATAGTGCTGTTATTTGG - Intronic
1150311448 17:64131983-64132005 TTTCATCTGCTGATGTTACAGGG - Intergenic
1151005248 17:70428249-70428271 TTTCACATAATGATTTTTTTAGG + Intergenic
1151141249 17:71993899-71993921 TTTCATTTCTGGATGTTATTGGG - Intergenic
1153348505 18:4053509-4053531 TTTCATATAGTGATACTCTTTGG - Intronic
1153390365 18:4550982-4551004 TTACATTTACTGATCTTAGTTGG - Intergenic
1153548208 18:6232261-6232283 TTTCATATACTGTTGATTTTGGG + Intronic
1153930225 18:9871848-9871870 TTTCATGAAATGATGTTATATGG - Intergenic
1155128403 18:22903634-22903656 TTTTATATAGTGATGTGGTTTGG - Intronic
1155198118 18:23493926-23493948 ATTCATATATTGTTGGTATTTGG - Intergenic
1155626323 18:27839015-27839037 ATCCATATAGTGATGGTATTTGG + Intergenic
1155779922 18:29818383-29818405 TTTCTTTAACTGATGTTGTTTGG + Intergenic
1156263146 18:35463162-35463184 TTTCCTTTCCAGATGTTATTAGG + Intronic
1156715145 18:39999342-39999364 TTTCATAATCTGATGTCATAAGG + Intergenic
1156796912 18:41057165-41057187 TTTCATTTACTGATCTTACCAGG - Intergenic
1156869713 18:41931521-41931543 TTTCATTTACTAATGTTATGAGG - Intergenic
1157039025 18:44015535-44015557 TTTCATTTAGTGATGGTATGTGG + Intergenic
1157847006 18:51013398-51013420 ATTCATATCTTGATGCTATTTGG + Intronic
1158067910 18:53435611-53435633 TTTCATATATTAAAGTTACTTGG + Intronic
1158094449 18:53754941-53754963 TTTCTTATACTCATGGTGTTAGG - Intergenic
1158261225 18:55608203-55608225 TTTAATATACTGATATTTTGAGG + Intronic
1162239097 19:9334119-9334141 TTTCAAATAATGATGTTATATGG - Intronic
1163877204 19:19882289-19882311 TTTCATAAACTGATTTTAGAAGG + Intronic
1163882259 19:19935409-19935431 TTTCATAAACTGATGTTAGAAGG - Exonic
1163903519 19:20129675-20129697 TTTCATATACTGATTTTATAAGG - Intergenic
1164014705 19:21243019-21243041 TTTCATATACTGATTTCAGGAGG - Intronic
1165563795 19:36705633-36705655 ATGCATATTCTGATGTTATTGGG + Intronic
925507020 2:4577922-4577944 TTTCATAATATGCTGTTATTTGG - Intergenic
925658199 2:6172715-6172737 TTTTATTTACAGTTGTTATTTGG - Intergenic
926858958 2:17287904-17287926 TTTCATATACAAATCTCATTGGG + Intergenic
927358197 2:22199517-22199539 TTTTATATACTGATATATTTTGG + Intergenic
928628373 2:33164598-33164620 TTTCTTATTTTGATGTCATTTGG + Intronic
929396683 2:41531703-41531725 ATTCATATGTTGATGGTATTTGG - Intergenic
930992413 2:57673448-57673470 ATTCATATTCTGATTTTAATTGG - Intergenic
931952874 2:67384946-67384968 ATTCATATACTGATAGGATTTGG + Intergenic
932452417 2:71820960-71820982 TATTATATACTGATATGATTTGG - Intergenic
933852026 2:86375849-86375871 TTTGACATACTGATATGATTAGG + Intergenic
935439790 2:103078948-103078970 ATTTATATTCTGAAGTTATTGGG + Intergenic
935482166 2:103604184-103604206 TTTCAGATATTGGTGTTAATAGG - Intergenic
935752955 2:106254615-106254637 CTTCATATATTTTTGTTATTAGG + Intergenic
935913374 2:107922148-107922170 CTTCATATATTTTTGTTATTAGG + Intergenic
938581457 2:132649987-132650009 TTACATATAGGGATTTTATTAGG - Intronic
938915232 2:135931655-135931677 TTTCATTCATTCATGTTATTTGG - Intronic
939232724 2:139451241-139451263 TTTGATATACTGATTTCCTTTGG + Intergenic
939282597 2:140083758-140083780 TTTCTTATACTGATATAGTTTGG - Intergenic
939385066 2:141485592-141485614 TTTCATATACTGTTGCTTTGGGG + Intronic
939513904 2:143142287-143142309 TTGCATATACAGAAGTTATTTGG - Intronic
939647911 2:144723656-144723678 ATGCATATTCTGCTGTTATTAGG - Intergenic
939649583 2:144744715-144744737 TTTGATATACTGATTTATTTGGG + Intergenic
939749816 2:146029293-146029315 TTTCTTATACTAAACTTATTTGG + Intergenic
940185945 2:150985092-150985114 TTTCATATACTCATTTACTTAGG - Intergenic
940383322 2:153041991-153042013 ATTCATATTTTGATGGTATTTGG + Intergenic
941304933 2:163852188-163852210 TTTTTTATACTGATTTTGTTTGG - Intergenic
943440066 2:187916987-187917009 TTTTATAACCTGATGTGATTTGG - Intergenic
943485784 2:188478682-188478704 ATTCAAATATTGCTGTTATTTGG + Intronic
943765238 2:191653976-191653998 ATTTATATGCTGATGGTATTTGG - Intergenic
944993443 2:205265427-205265449 TTTGATGTGCTGATGTAATTTGG + Intronic
945604734 2:211914747-211914769 TTTCAAATTATCATGTTATTTGG - Intronic
946042467 2:216794198-216794220 TTTGATATACTGATTTCCTTTGG - Intergenic
1169824605 20:9753625-9753647 TTTCATACAATGATGGGATTAGG - Intronic
1171814721 20:29775480-29775502 TTTTATAAACTGATTTTAGTAGG + Intergenic
1175597707 20:60248451-60248473 TCTCATATAATGATTTTATAAGG - Intergenic
1176953697 21:15074938-15074960 TATCATATATTGATTTTGTTGGG + Intergenic
1178704640 21:34863255-34863277 TTTCTTGTACTGGTGCTATTGGG - Intronic
1179026402 21:37682635-37682657 TTTCCTATAAGGATGTAATTAGG - Intronic
1180821307 22:18830117-18830139 TTTCTGATACTGATGATATAAGG + Intergenic
1181191671 22:21145928-21145950 TTTCTGATACTGATGATATAAGG - Intergenic
1181207526 22:21264582-21264604 TTTCTGATACTGATGATATAAGG + Intergenic
1182720945 22:32399544-32399566 TTTCATATTTTGTTTTTATTGGG - Intronic
1184819753 22:46900852-46900874 CTTCATGTACTAATCTTATTGGG + Intronic
1203219393 22_KI270731v1_random:30834-30856 TTTCTGATACTGATGATATAAGG - Intergenic
1203271432 22_KI270734v1_random:55993-56015 TTTCTGATACTGATGATATAAGG + Intergenic
949246897 3:1935562-1935584 ATTCATTTAATGATGATATTAGG - Intergenic
949376663 3:3398175-3398197 ATGTATATTCTGATGTTATTGGG + Intergenic
949518853 3:4831424-4831446 TCTCACATACCGATGTCATTAGG - Intronic
949773341 3:7602992-7603014 TTTTATAAACTCATTTTATTAGG + Intronic
950326741 3:12117599-12117621 TTCCAGTTCCTGATGTTATTTGG - Intronic
952487827 3:33833558-33833580 TTTCATATTCTTTTGCTATTTGG + Intronic
952536436 3:34314950-34314972 TTTGATATACTGATTTCTTTTGG + Intergenic
952605461 3:35142128-35142150 TGGCATATAGGGATGTTATTTGG - Intergenic
952971459 3:38653297-38653319 TTTCATATTCTGGTTTTAATTGG + Intergenic
953081826 3:39627921-39627943 TTTGATATACTGATTTCTTTTGG - Intergenic
953088086 3:39693431-39693453 TTTCTTATATTGATGTTTTATGG - Intergenic
955223116 3:57039337-57039359 TCTCATATACTGCTGTTGCTGGG + Intronic
955855540 3:63269073-63269095 AATTATATACTTATGTTATTAGG - Intronic
956244376 3:67165294-67165316 TTTTATATTCTGCGGTTATTGGG + Intergenic
956570620 3:70690492-70690514 TTTAATATCCATATGTTATTGGG + Intergenic
956684577 3:71812942-71812964 TTTCAGTTAGTGATATTATTTGG - Intergenic
957901692 3:86502290-86502312 TTTCATATAGTGATATGGTTTGG - Intergenic
958084123 3:88784240-88784262 TGTCATATACATATGTTCTTTGG - Intergenic
958931367 3:100211505-100211527 TTGCATATACTGAATATATTAGG - Intergenic
958976222 3:100670489-100670511 TTTGATATACTGATTTCTTTTGG + Intronic
959317348 3:104824237-104824259 TTTCATACACTGTTGCTATGAGG + Intergenic
961931848 3:130542275-130542297 TTTCTTCTACTCATTTTATTTGG + Intergenic
962194529 3:133349940-133349962 TTTGATATACTGATTTCCTTTGG - Intronic
962324290 3:134420460-134420482 TAAAATATACTGATGTTGTTAGG + Intergenic
962592137 3:136901734-136901756 TTTCATTTTCTGATTTTACTTGG + Intronic
963449325 3:145457794-145457816 GTTCAAATACTGATTTTATATGG + Intergenic
963575507 3:147057094-147057116 TTTCATGTATTGATGTCAGTCGG - Intergenic
964721617 3:159772565-159772587 TTTTATATACAGTTGTTATCTGG + Intronic
965048848 3:163617580-163617602 TTTGATATACTCATTTTGTTTGG - Intergenic
965165581 3:165191971-165191993 TTTCATATACTGATGTTATTAGG - Intronic
965929033 3:174019248-174019270 ATTCATATGTTGATGGTATTTGG + Intronic
966366362 3:179191936-179191958 TTTAAAATACTTATGTTTTTAGG - Intronic
967572824 3:191050907-191050929 TTTCCTATACTGGTGTTGTGTGG - Intergenic
967649181 3:191964300-191964322 TTTCCTATACAAATATTATTGGG + Intergenic
970405394 4:15757980-15758002 TTAAAAATGCTGATGTTATTGGG - Intergenic
972969112 4:44550185-44550207 TTTCAGCTCCTGACGTTATTGGG + Intergenic
973088543 4:46101043-46101065 TTTCATGTCCTGATGTTTTTTGG + Intronic
973924527 4:55723957-55723979 TTTCATTTAGAGATGTTAGTAGG - Intergenic
973966723 4:56170454-56170476 TTTTATATACTTTTGGTATTGGG + Intronic
974342734 4:60635248-60635270 TTTCATATTCTGTTGTTGTTAGG + Intergenic
974434265 4:61836930-61836952 TTTCTTATCCTTATTTTATTTGG - Intronic
974553350 4:63409790-63409812 TTTCATTTACTTATGTTAGCCGG + Intergenic
974732003 4:65878938-65878960 TTGCATATCCTGATTGTATTGGG + Intergenic
975279785 4:72547972-72547994 ATTCATAAAGTAATGTTATTTGG + Intronic
975398349 4:73904081-73904103 TTTCATGCACTGATTTAATTAGG + Intergenic
975780033 4:77829045-77829067 ATTTAAATACTGATGTTCTTTGG - Intergenic
976015282 4:80544889-80544911 ATGCATATTCTGTTGTTATTGGG - Intronic
976128918 4:81863435-81863457 TTCCATATACTGATTTCTTTTGG - Intronic
976274245 4:83260141-83260163 TTCAATATATTGATGTTTTTTGG - Intergenic
976636965 4:87295856-87295878 TTTCAAAAACTCATGTGATTTGG + Intergenic
977019064 4:91736617-91736639 ATTCATATGTTGATGATATTTGG + Intergenic
977237133 4:94521940-94521962 TTTCATTTGCTGATTTTAGTAGG + Intronic
977419829 4:96785152-96785174 TTTTAAATAATGTTGTTATTGGG + Intergenic
978126523 4:105142753-105142775 TTTCCTAATCTGATTTTATTTGG - Intergenic
978489311 4:109294780-109294802 TAACATAGATTGATGTTATTTGG + Intronic
978787680 4:112627944-112627966 TTTCATACATTCATGTTGTTGGG + Intronic
979053661 4:115969634-115969656 CTTTATTTACTTATGTTATTGGG + Intergenic
979184938 4:117776270-117776292 TTTGATATACTAATTTTTTTTGG - Intergenic
981519808 4:145649671-145649693 TTTCTTATTCCAATGTTATTAGG - Intronic
981917084 4:150046265-150046287 TTTCCTAAACTGATGTGAGTTGG - Intergenic
982417552 4:155154208-155154230 TTTCATTTTTTAATGTTATTTGG - Intergenic
983114349 4:163794183-163794205 TCTCATACACTGATGTTAGCTGG - Intronic
983352379 4:166607595-166607617 TTTCATATAATGGTTTTGTTAGG - Intergenic
983475834 4:168210795-168210817 ATTCATATGTTGATGATATTTGG + Intergenic
984023391 4:174514050-174514072 TTTCTTATAATGTTCTTATTTGG - Intronic
984367997 4:178822730-178822752 TTTTATATACTGATATAGTTTGG - Intergenic
985333978 4:188872041-188872063 TTGGATACACTGATGTCATTCGG - Intergenic
986630693 5:9769396-9769418 TTTTATATACTGATTTCTTTGGG + Intergenic
986847880 5:11776948-11776970 TTTCTTATACTGTTTTTATTAGG - Intronic
986861631 5:11932975-11932997 GTACATAGACTGATGATATTTGG - Intergenic
987900514 5:24004864-24004886 TTTCATAAACTTATTTTATCAGG + Intronic
988476795 5:31593531-31593553 TTACTAATGCTGATGTTATTTGG - Intergenic
988890675 5:35613750-35613772 TTTCATTTGCTGATTTTATTTGG - Intergenic
989064689 5:37447963-37447985 CCTCATTAACTGATGTTATTTGG + Intronic
989141679 5:38207732-38207754 TTTAATAAACTGATGGTATAAGG + Intergenic
989311851 5:40027804-40027826 TTTGATACACTGATATGATTTGG - Intergenic
989461655 5:41706433-41706455 ATATATATACTGCTGTTATTGGG + Intergenic
990235292 5:53760694-53760716 TTAATTATACTGATGCTATTAGG - Intergenic
990398266 5:55407377-55407399 ATTTATATGCTAATGTTATTGGG + Intronic
990862764 5:60346065-60346087 TTTCTTCTACTTATTTTATTTGG + Intronic
992883492 5:81133942-81133964 TTTAAAATACTGATGATATCTGG + Intronic
993022542 5:82608915-82608937 TTTCAGTTTCTGATTTTATTTGG - Intergenic
993259099 5:85635508-85635530 TTTCTCATACTGATCTTGTTTGG - Intergenic
993518321 5:88865191-88865213 TTTAAAATACTGATGTTAGGTGG - Intronic
993542905 5:89174500-89174522 TTTAATATACTTATGTTGTGTGG + Intergenic
993560055 5:89395578-89395600 TTTCATATAATGCTTTTTTTTGG + Intergenic
994201784 5:96984780-96984802 TTTCAAATACTCATCTTTTTAGG + Intronic
994268454 5:97746154-97746176 TTGCAGATACTGATGCTATATGG - Intergenic
994418492 5:99503793-99503815 CCTCATTAACTGATGTTATTTGG + Intergenic
994444172 5:99852142-99852164 ATTCATCTACTGATGGCATTTGG - Intergenic
994461467 5:100071348-100071370 CCTCATTAACTGATGTTATTTGG - Intergenic
994687492 5:102973446-102973468 TTTAATAAACTGATATCATTAGG - Intronic
994988587 5:106969367-106969389 ATTCATTTGCTGATGGTATTTGG - Intergenic
996253070 5:121361954-121361976 TTTCAAACACTGATGTCATATGG - Intergenic
996281729 5:121737994-121738016 GTTCATATATTGATGCTTTTGGG - Intergenic
999355349 5:150924257-150924279 TTTCTTATACTGTTCTTATCTGG + Intergenic
1000167105 5:158661108-158661130 TTTTCTTTACTGATGCTATTTGG - Intergenic
1000208238 5:159083080-159083102 TATGATATATAGATGTTATTTGG + Intronic
1001032010 5:168269838-168269860 TTACATATATTGTTTTTATTAGG - Intergenic
1003521831 6:6864808-6864830 TTACATATACTTGAGTTATTTGG - Intergenic
1004033190 6:11893805-11893827 ATTCATTTAGTGATTTTATTGGG + Intergenic
1004849706 6:19686223-19686245 TTTGATAAACTGAGGTTCTTAGG - Intergenic
1005780046 6:29181427-29181449 TTACGTATCCTGATGTTTTTTGG + Intergenic
1007028378 6:38601851-38601873 TTTCATATAATTATTTTATGTGG - Intronic
1007031731 6:38634286-38634308 TTTCATATACTGAAGACTTTTGG - Intronic
1008756454 6:54800439-54800461 TATCATTTACTGATGGTATCTGG + Intergenic
1008895605 6:56551269-56551291 TTTTATAAACTGTTTTTATTTGG + Intronic
1009737480 6:67695756-67695778 TTGCCTATTCTGATATTATTAGG - Intergenic
1011427390 6:87245318-87245340 AATCATATTCTGATTTTATTTGG + Intronic
1011814033 6:91167373-91167395 TTTCATAAAGTCATGCTATTTGG - Intergenic
1012172133 6:96030168-96030190 TTCCATGTTCTGCTGTTATTGGG - Intronic
1012710501 6:102597065-102597087 TTTCAGGTACTTATTTTATTTGG - Intergenic
1014673886 6:124340983-124341005 TTTGGTATACTGTTTTTATTTGG + Intronic
1015002395 6:128234104-128234126 TTTCATATCCTCAAGTTATAAGG + Intronic
1015428428 6:133100674-133100696 TTTTATTTAATGATTTTATTTGG - Intergenic
1015581271 6:134728043-134728065 TTTCATATACTGCTTTACTTTGG - Intergenic
1015706944 6:136098317-136098339 TTTCAGAAACTAATGTTATTAGG - Intronic
1016316551 6:142795280-142795302 TCTCATTTATTGATGTTATTTGG + Intronic
1016652886 6:146483600-146483622 ATTCATATGTTGATGATATTTGG - Intergenic
1017301361 6:152863169-152863191 TTTCATATTCTTAGTTTATTAGG - Intergenic
1017566157 6:155689270-155689292 TTTCATAGACTGTTGGTATGAGG - Intergenic
1017593872 6:156007649-156007671 TTTCCTATAATAATGTAATTAGG + Intergenic
1017974484 6:159344343-159344365 TTTGATATACTGATTTCCTTTGG - Intergenic
1019114291 6:169745415-169745437 TTTCATATAGAGCTTTTATTAGG + Intronic
1019845178 7:3492066-3492088 TTTCAAAGCCAGATGTTATTTGG + Intronic
1020354997 7:7266188-7266210 ATTCAAATGCTAATGTTATTTGG - Intergenic
1022035663 7:26531766-26531788 TTTCATTTATTTATTTTATTTGG - Intergenic
1023617258 7:42032556-42032578 TCTCATATACTGTTTTAATTGGG - Intronic
1023762131 7:43474555-43474577 TTTAATATAATGTTATTATTTGG - Intronic
1024344278 7:48297057-48297079 ATTCACATACAGATGGTATTGGG + Intronic
1026304628 7:69129845-69129867 TTTTAAATCCTGATGTGATTTGG - Intergenic
1026361559 7:69605536-69605558 TTTCATATATTGCTGCTCTTTGG + Intronic
1026542502 7:71292399-71292421 TTTCAAATCCTCATGTTGTTTGG + Intronic
1027565855 7:79792721-79792743 TTAAATATAATGATATTATTGGG - Intergenic
1028598759 7:92577420-92577442 TTTCTTCTACTGATATTTTTAGG + Intronic
1028757408 7:94453389-94453411 TTGCATATATTTATGCTATTGGG + Intergenic
1029098682 7:98109360-98109382 TTTCATATTCTGATCTTTGTAGG + Intronic
1029938692 7:104456564-104456586 TATCATATACTGAGGTTGCTAGG - Intronic
1030560589 7:111079783-111079805 ATTCATATACTGATGGCACTTGG + Intronic
1030855524 7:114550902-114550924 TTTGATATGGTTATGTTATTTGG + Intronic
1030969434 7:116036490-116036512 ATTCACATGCTGATGGTATTTGG - Intronic
1031520815 7:122763408-122763430 ATTCATATACTGCTGTAACTGGG - Intronic
1031629147 7:124025224-124025246 TTTTGTGTAATGATGTTATTGGG - Intergenic
1031798119 7:126204323-126204345 TTTTATATACTTATGTAATTTGG - Intergenic
1032189677 7:129757315-129757337 TTTCTTATACTGACGTTCTGGGG + Intergenic
1032615067 7:133459686-133459708 TTTCATTTACTGATAGAATTGGG + Intronic
1033205998 7:139423428-139423450 TTACATATACTGTTTTTATTTGG - Exonic
1033895287 7:146062144-146062166 TTTCATTGACTGGTGTGATTAGG - Intergenic
1034044553 7:147914103-147914125 TTTCAGAAAATGATGTTATAAGG + Intronic
1034082117 7:148288492-148288514 ATTCATATGTTGATGGTATTTGG - Intronic
1036593253 8:10188210-10188232 TTTTAAATACAGATCTTATTTGG + Intronic
1037006634 8:13789624-13789646 TTTCATATACTGATTAAATCTGG - Intergenic
1038208933 8:25497257-25497279 TTTGATATACTGATTTCCTTTGG - Intronic
1039341991 8:36660421-36660443 TTTCTTGTAGTGATGTTATATGG - Intergenic
1041517774 8:58720323-58720345 TTCCTTATACTGTTGTTATGGGG - Intergenic
1041519859 8:58743544-58743566 ATTCATACACTGATTTTATTGGG - Intergenic
1041847801 8:62351708-62351730 TTTCATATTATGATGCTATTTGG - Intronic
1042131156 8:65587831-65587853 ATTTATATACTGATGGTATTAGG - Intergenic
1042690919 8:71497725-71497747 TTTGACATACTGATTTTCTTTGG - Intronic
1042820078 8:72920831-72920853 TTTTGTATTCTGTTGTTATTTGG - Intronic
1042889948 8:73597999-73598021 TTTCTTATACTGTTCTTGTTGGG - Intronic
1043804683 8:84657027-84657049 TTTCTTATACTCATGTAATGTGG - Intronic
1043887679 8:85620893-85620915 TTTCATATTTTAATTTTATTGGG - Intergenic
1044350224 8:91156038-91156060 TTTGATATACTGATTTCCTTTGG + Intronic
1045403162 8:101838963-101838985 TTTCAACTACCCATGTTATTGGG + Intronic
1045873657 8:106953872-106953894 TTTTATTTACCGATGTTCTTTGG + Intergenic
1046207048 8:111014724-111014746 ATTCATATACTGATATGGTTTGG + Intergenic
1046289415 8:112137304-112137326 CTTCAGATAGTGATCTTATTTGG + Intergenic
1046321688 8:112585601-112585623 TTTCCTATACTGGTATTATTTGG - Intronic
1046418381 8:113944991-113945013 TTTCAGATACTGATGTGTTTAGG + Intergenic
1046418426 8:113946100-113946122 TTTCAAATAATGATATTACTGGG + Intergenic
1046478485 8:114781756-114781778 TTTCATATTTTAATGTGATTAGG - Intergenic
1046624518 8:116562579-116562601 TTGCATTTACAGATGTTATCAGG + Intergenic
1046850590 8:118968274-118968296 TTTCTTGTAGTGATGTCATTTGG + Intergenic
1047831829 8:128641367-128641389 TTTTCTTTACTGATGTTCTTAGG + Intergenic
1048245957 8:132799542-132799564 TTTTCTATTCTGCTGTTATTTGG + Intronic
1048311476 8:133325720-133325742 TTGCTTAAACTGCTGTTATTTGG + Intergenic
1049127201 8:140802446-140802468 TTTTATAAACTGATTTTTTTCGG - Intronic
1050183929 9:2951243-2951265 TTTCTTATCCTGAGGTTATCTGG - Intergenic
1050564187 9:6865410-6865432 TTACATATAGCTATGTTATTAGG + Intronic
1050882229 9:10716639-10716661 TTTGATATACTGATTTCTTTTGG + Intergenic
1050941603 9:11467465-11467487 CTAAATATAATGATGTTATTTGG + Intergenic
1051068983 9:13139379-13139401 TTTCATAGGCAGCTGTTATTAGG - Intronic
1052143411 9:25017813-25017835 TTTTATTTGCTGATGTTAATAGG - Intergenic
1052233783 9:26186787-26186809 TTGCATATCCTGATTGTATTGGG - Intergenic
1052358083 9:27527088-27527110 TTTCCTATAGTGATTTTTTTGGG + Intronic
1052380792 9:27768608-27768630 TTTGATATACTGATGCTCTATGG + Intergenic
1055205106 9:73720402-73720424 GTGAATATACTGATGTTTTTGGG + Intergenic
1055229610 9:74046251-74046273 TTTCATTTTGTGATGGTATTTGG - Intergenic
1055989771 9:82092943-82092965 TTTCATATAATAATTTTACTTGG + Intergenic
1056499690 9:87196714-87196736 TTGCATCTACTGACTTTATTTGG + Intergenic
1058289862 9:103226062-103226084 TTTCATATAAACATGTTATAAGG + Intergenic
1058777374 9:108297614-108297636 ATTCATATGTTGATGGTATTTGG - Intergenic
1059189211 9:112307585-112307607 TTTCATGTTCTGAAATTATTAGG - Intronic
1062156995 9:135055693-135055715 TATGATATACTGATATGATTTGG - Intergenic
1187957336 X:24532374-24532396 TTTCATAAACTGAAGTATTTTGG + Intronic
1188143323 X:26579175-26579197 TTACAAATACTAATGGTATTGGG + Intergenic
1188276289 X:28205639-28205661 TTTTATAAACTGATGATAGTTGG + Intergenic
1188629043 X:32328231-32328253 TATCATTTCCTGATGATATTTGG - Intronic
1188713142 X:33426951-33426973 TATCATATACTGATTTTTTTGGG - Intergenic
1189029024 X:37430493-37430515 ATTAATATATTGATGTTTTTGGG - Intronic
1190933319 X:54969545-54969567 TTTCATCTGCTGATATAATTTGG - Intronic
1192142449 X:68657538-68657560 TTTCATATACTGAAATTTTCTGG - Intronic
1192967775 X:76197320-76197342 TTTCTTCTACTAATTTTATTAGG + Intergenic
1194144870 X:90249454-90249476 TTTTATATTCTGTTGTTTTTAGG - Intergenic
1194249491 X:91557016-91557038 TTTCTTATATTGCTATTATTTGG - Intergenic
1194692043 X:96999134-96999156 TTTAGTACACTGATCTTATTTGG + Intronic
1194899681 X:99495379-99495401 TTTAAGGTGCTGATGTTATTAGG - Intergenic
1195741325 X:108067594-108067616 TTTAAAATGCTAATGTTATTTGG + Intronic
1195901728 X:109805212-109805234 TTTCTTGTACTGATCTTATCTGG - Intergenic
1196102134 X:111857560-111857582 CATCAAATACTGATGTTATGTGG + Intronic
1196292362 X:113958005-113958027 ATTCAGATACTGAGGTTAATGGG + Intergenic
1196386441 X:115158875-115158897 TTTCTTATACTGATTTTCTTTGG - Intronic
1196438811 X:115699890-115699912 TTTTAAATTTTGATGTTATTTGG - Intergenic
1196472260 X:116041577-116041599 TTTGATTTACATATGTTATTGGG - Intergenic
1196642222 X:118075309-118075331 TTTTTTATACTGATGATACTGGG + Intronic
1197270952 X:124424256-124424278 ATTCATATGCTGATGGCATTTGG + Intronic
1197385805 X:125799636-125799658 TTTCATACACTAAAGATATTTGG - Intergenic
1197470399 X:126861272-126861294 TTTGATATACTGATTTCCTTTGG - Intergenic
1197707096 X:129641832-129641854 ATTCATATGTTGATGGTATTTGG - Intergenic
1198076902 X:133202384-133202406 TTTCATATACTCTGGATATTGGG + Intergenic
1198549355 X:137728327-137728349 TTCCATATACTGATTTCCTTTGG - Intergenic
1198764984 X:140071361-140071383 ATTCATATGCTGATGGCATTTGG - Intergenic
1199408940 X:147496714-147496736 ATTCATATATTGATTTTGTTTGG + Intergenic
1199612387 X:149629703-149629725 TTTCATATACTAATTTTTTTGGG + Intronic
1200447657 Y:3285010-3285032 TTTCATAAACTGATATAATGAGG + Intergenic
1200490627 Y:3818758-3818780 TTTTATATTCTGTTGTTTTTAGG - Intergenic
1200568449 Y:4798231-4798253 TTTCTTATATTGCTATTATTTGG - Intergenic
1200876817 Y:8164974-8164996 TTTCAGATACTGGTATTATTTGG + Intergenic
1201546772 Y:15173773-15173795 GTAAATATACTGCTGTTATTTGG + Intergenic
1202131341 Y:21613996-21614018 TTTCATATACTAAAGTTCTGAGG + Intergenic