ID: 965184592

View in Genome Browser
Species Human (GRCh38)
Location 3:165446700-165446722
Sequence GCACACCTGGTTAAGTAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965184592_965184598 6 Left 965184592 3:165446700-165446722 CCTGACTACTTAACCAGGTGTGC No data
Right 965184598 3:165446729-165446751 CAAGTTCGCATTTCCTTATAGGG No data
965184592_965184597 5 Left 965184592 3:165446700-165446722 CCTGACTACTTAACCAGGTGTGC No data
Right 965184597 3:165446728-165446750 GCAAGTTCGCATTTCCTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965184592 Original CRISPR GCACACCTGGTTAAGTAGTC AGG (reversed) Intergenic
No off target data available for this crispr