ID: 965185611

View in Genome Browser
Species Human (GRCh38)
Location 3:165458866-165458888
Sequence TGTATCCCATGCTAGGTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965185611_965185614 -1 Left 965185611 3:165458866-165458888 CCTTAGACCTAGCATGGGATACA No data
Right 965185614 3:165458888-165458910 ATAGATATGGTTAAGTTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965185611 Original CRISPR TGTATCCCATGCTAGGTCTA AGG (reversed) Intergenic
No off target data available for this crispr