ID: 965186283

View in Genome Browser
Species Human (GRCh38)
Location 3:165468495-165468517
Sequence TTGGACAAGCAGGAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965186283_965186288 13 Left 965186283 3:165468495-165468517 CCTTCCTCTTCCTGCTTGTCCAA No data
Right 965186288 3:165468531-165468553 ATAATATCTATACAGCAACTTGG No data
965186283_965186289 22 Left 965186283 3:165468495-165468517 CCTTCCTCTTCCTGCTTGTCCAA No data
Right 965186289 3:165468540-165468562 ATACAGCAACTTGGTAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965186283 Original CRISPR TTGGACAAGCAGGAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr