ID: 965189463

View in Genome Browser
Species Human (GRCh38)
Location 3:165509283-165509305
Sequence GCTGGGACATTGATCTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965189462_965189463 -10 Left 965189462 3:165509270-165509292 CCTGATTGTTTTAGCTGGGACAT No data
Right 965189463 3:165509283-165509305 GCTGGGACATTGATCTTTTCTGG No data
965189459_965189463 -3 Left 965189459 3:165509263-165509285 CCTACTGCCTGATTGTTTTAGCT No data
Right 965189463 3:165509283-165509305 GCTGGGACATTGATCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965189463 Original CRISPR GCTGGGACATTGATCTTTTC TGG Intergenic
No off target data available for this crispr