ID: 965190571

View in Genome Browser
Species Human (GRCh38)
Location 3:165522666-165522688
Sequence TAGGGGATAAAGAAGTGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965190560_965190571 24 Left 965190560 3:165522619-165522641 CCTAAGAGTCTTAAGACCCTGAA No data
Right 965190571 3:165522666-165522688 TAGGGGATAAAGAAGTGGAATGG No data
965190568_965190571 -8 Left 965190568 3:165522651-165522673 CCTCCTTTGGTGATCTAGGGGAT No data
Right 965190571 3:165522666-165522688 TAGGGGATAAAGAAGTGGAATGG No data
965190562_965190571 8 Left 965190562 3:165522635-165522657 CCCTGAAGGACTTGTGCCTCCTT No data
Right 965190571 3:165522666-165522688 TAGGGGATAAAGAAGTGGAATGG No data
965190563_965190571 7 Left 965190563 3:165522636-165522658 CCTGAAGGACTTGTGCCTCCTTT No data
Right 965190571 3:165522666-165522688 TAGGGGATAAAGAAGTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965190571 Original CRISPR TAGGGGATAAAGAAGTGGAA TGG Intergenic
No off target data available for this crispr