ID: 965190622

View in Genome Browser
Species Human (GRCh38)
Location 3:165523556-165523578
Sequence CTCAAGAAGGAGAAGTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965190622_965190625 2 Left 965190622 3:165523556-165523578 CCCTCTGACTTCTCCTTCTTGAG No data
Right 965190625 3:165523581-165523603 ACTACACTTGTACTCTATTAAGG No data
965190622_965190626 27 Left 965190622 3:165523556-165523578 CCCTCTGACTTCTCCTTCTTGAG No data
Right 965190626 3:165523606-165523628 ATAGTTTTTCTTCCTGCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965190622 Original CRISPR CTCAAGAAGGAGAAGTCAGA GGG (reversed) Intergenic
No off target data available for this crispr