ID: 965191608

View in Genome Browser
Species Human (GRCh38)
Location 3:165537595-165537617
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965191608_965191610 8 Left 965191608 3:165537595-165537617 CCAGTTAGAAATAGCCTAGAGTC No data
Right 965191610 3:165537626-165537648 GTTTATTCATACCAAATAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965191608 Original CRISPR GACTCTAGGCTATTTCTAAC TGG (reversed) Intergenic
No off target data available for this crispr