ID: 965192576

View in Genome Browser
Species Human (GRCh38)
Location 3:165550343-165550365
Sequence GTTTTTATGCAGAAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965192574_965192576 -2 Left 965192574 3:165550322-165550344 CCATATTGTATTAAAAATAATGT No data
Right 965192576 3:165550343-165550365 GTTTTTATGCAGAAAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965192576 Original CRISPR GTTTTTATGCAGAAAGTGGA AGG Intergenic
No off target data available for this crispr