ID: 965193881

View in Genome Browser
Species Human (GRCh38)
Location 3:165568688-165568710
Sequence ACTCAGAAACAGAAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965193879_965193881 -9 Left 965193879 3:165568674-165568696 CCTTAAATAGTCAAACTCAGAAA No data
Right 965193881 3:165568688-165568710 ACTCAGAAACAGAAAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965193881 Original CRISPR ACTCAGAAACAGAAAGTGGA AGG Intergenic
No off target data available for this crispr