ID: 965199031

View in Genome Browser
Species Human (GRCh38)
Location 3:165632730-165632752
Sequence CAAGCCCAGTGGATTGATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965199022_965199031 26 Left 965199022 3:165632681-165632703 CCAGAACATTCCTCTAGTCACTA No data
Right 965199031 3:165632730-165632752 CAAGCCCAGTGGATTGATTTGGG No data
965199020_965199031 28 Left 965199020 3:165632679-165632701 CCCCAGAACATTCCTCTAGTCAC No data
Right 965199031 3:165632730-165632752 CAAGCCCAGTGGATTGATTTGGG No data
965199028_965199031 -9 Left 965199028 3:165632716-165632738 CCACTCTCTCTGCTCAAGCCCAG No data
Right 965199031 3:165632730-165632752 CAAGCCCAGTGGATTGATTTGGG No data
965199027_965199031 -4 Left 965199027 3:165632711-165632733 CCAATCCACTCTCTCTGCTCAAG No data
Right 965199031 3:165632730-165632752 CAAGCCCAGTGGATTGATTTGGG No data
965199025_965199031 16 Left 965199025 3:165632691-165632713 CCTCTAGTCACTATAAGGGCCCA No data
Right 965199031 3:165632730-165632752 CAAGCCCAGTGGATTGATTTGGG No data
965199021_965199031 27 Left 965199021 3:165632680-165632702 CCCAGAACATTCCTCTAGTCACT No data
Right 965199031 3:165632730-165632752 CAAGCCCAGTGGATTGATTTGGG No data
965199026_965199031 -3 Left 965199026 3:165632710-165632732 CCCAATCCACTCTCTCTGCTCAA No data
Right 965199031 3:165632730-165632752 CAAGCCCAGTGGATTGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965199031 Original CRISPR CAAGCCCAGTGGATTGATTT GGG Intergenic
No off target data available for this crispr