ID: 965208708

View in Genome Browser
Species Human (GRCh38)
Location 3:165756111-165756133
Sequence GAGTTCTGTACCACAGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965208704_965208708 0 Left 965208704 3:165756088-165756110 CCAATGCCTTGGTTGAGATCCCA No data
Right 965208708 3:165756111-165756133 GAGTTCTGTACCACAGAGCATGG No data
965208705_965208708 -6 Left 965208705 3:165756094-165756116 CCTTGGTTGAGATCCCAGAGTTC No data
Right 965208708 3:165756111-165756133 GAGTTCTGTACCACAGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965208708 Original CRISPR GAGTTCTGTACCACAGAGCA TGG Intergenic
No off target data available for this crispr