ID: 965226766

View in Genome Browser
Species Human (GRCh38)
Location 3:166000756-166000778
Sequence GACAGCTCTTGGCCTGTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965226766_965226769 11 Left 965226766 3:166000756-166000778 CCACTAACAGGCCAAGAGCTGTC No data
Right 965226769 3:166000790-166000812 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247
965226766_965226770 15 Left 965226766 3:166000756-166000778 CCACTAACAGGCCAAGAGCTGTC No data
Right 965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965226766 Original CRISPR GACAGCTCTTGGCCTGTTAG TGG (reversed) Intergenic
No off target data available for this crispr