ID: 965226770

View in Genome Browser
Species Human (GRCh38)
Location 3:166000794-166000816
Sequence AGTTATCTGCAGAAGATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965226764_965226770 22 Left 965226764 3:166000749-166000771 CCAAAGCCCACTAACAGGCCAAG No data
Right 965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG No data
965226766_965226770 15 Left 965226766 3:166000756-166000778 CCACTAACAGGCCAAGAGCTGTC No data
Right 965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG No data
965226768_965226770 4 Left 965226768 3:166000767-166000789 CCAAGAGCTGTCTCTCAAAAGGA 0: 181
1: 197
2: 163
3: 130
4: 293
Right 965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG No data
965226765_965226770 16 Left 965226765 3:166000755-166000777 CCCACTAACAGGCCAAGAGCTGT No data
Right 965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG No data
965226763_965226770 25 Left 965226763 3:166000746-166000768 CCACCAAAGCCCACTAACAGGCC No data
Right 965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965226770 Original CRISPR AGTTATCTGCAGAAGATGGT AGG Intergenic
No off target data available for this crispr