ID: 965229269

View in Genome Browser
Species Human (GRCh38)
Location 3:166029526-166029548
Sequence ACCCAGGATGTTCCTGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965229262_965229269 18 Left 965229262 3:166029485-166029507 CCTGTCTGCCTCCTGCCACCATC 0: 41
1: 78
2: 143
3: 252
4: 808
Right 965229269 3:166029526-166029548 ACCCAGGATGTTCCTGCCCAGGG No data
965229263_965229269 10 Left 965229263 3:166029493-166029515 CCTCCTGCCACCATCAATCACGT No data
Right 965229269 3:166029526-166029548 ACCCAGGATGTTCCTGCCCAGGG No data
965229266_965229269 0 Left 965229266 3:166029503-166029525 CCATCAATCACGTCATGCACAGC No data
Right 965229269 3:166029526-166029548 ACCCAGGATGTTCCTGCCCAGGG No data
965229264_965229269 7 Left 965229264 3:166029496-166029518 CCTGCCACCATCAATCACGTCAT No data
Right 965229269 3:166029526-166029548 ACCCAGGATGTTCCTGCCCAGGG No data
965229261_965229269 29 Left 965229261 3:166029474-166029496 CCACTCAAGAGCCTGTCTGCCTC No data
Right 965229269 3:166029526-166029548 ACCCAGGATGTTCCTGCCCAGGG No data
965229265_965229269 3 Left 965229265 3:166029500-166029522 CCACCATCAATCACGTCATGCAC No data
Right 965229269 3:166029526-166029548 ACCCAGGATGTTCCTGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965229269 Original CRISPR ACCCAGGATGTTCCTGCCCA GGG Intergenic
No off target data available for this crispr