ID: 965229988

View in Genome Browser
Species Human (GRCh38)
Location 3:166038284-166038306
Sequence CAGCAATTCTAGAGGACATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965229988_965230000 20 Left 965229988 3:166038284-166038306 CCAAATGTCCTCTAGAATTGCTG No data
Right 965230000 3:166038327-166038349 CATGGGAGGGACCCAGTGGGAGG 0: 530
1: 1103
2: 2381
3: 3775
4: 4654
965229988_965229995 7 Left 965229988 3:166038284-166038306 CCAAATGTCCTCTAGAATTGCTG No data
Right 965229995 3:166038314-166038336 AATTCCCACATGTCATGGGAGGG 0: 182
1: 866
2: 3319
3: 5812
4: 7115
965229988_965229993 3 Left 965229988 3:166038284-166038306 CCAAATGTCCTCTAGAATTGCTG No data
Right 965229993 3:166038310-166038332 GGATAATTCCCACATGTCATGGG No data
965229988_965229994 6 Left 965229988 3:166038284-166038306 CCAAATGTCCTCTAGAATTGCTG No data
Right 965229994 3:166038313-166038335 TAATTCCCACATGTCATGGGAGG 0: 147
1: 895
2: 2954
3: 5827
4: 7483
965229988_965229998 16 Left 965229988 3:166038284-166038306 CCAAATGTCCTCTAGAATTGCTG No data
Right 965229998 3:166038323-166038345 ATGTCATGGGAGGGACCCAGTGG 0: 252
1: 843
2: 2228
3: 4473
4: 6055
965229988_965229999 17 Left 965229988 3:166038284-166038306 CCAAATGTCCTCTAGAATTGCTG No data
Right 965229999 3:166038324-166038346 TGTCATGGGAGGGACCCAGTGGG 0: 579
1: 1302
2: 3253
3: 5050
4: 6076
965229988_965229992 2 Left 965229988 3:166038284-166038306 CCAAATGTCCTCTAGAATTGCTG No data
Right 965229992 3:166038309-166038331 CGGATAATTCCCACATGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965229988 Original CRISPR CAGCAATTCTAGAGGACATT TGG (reversed) Intergenic
No off target data available for this crispr