ID: 965242312

View in Genome Browser
Species Human (GRCh38)
Location 3:166217669-166217691
Sequence CTGTGGAAGGCTGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965242312_965242318 -8 Left 965242312 3:166217669-166217691 CCTTCCACCTCAGCCTTCCACAG No data
Right 965242318 3:166217684-166217706 TTCCACAGTACTGGGATCACAGG No data
965242312_965242322 30 Left 965242312 3:166217669-166217691 CCTTCCACCTCAGCCTTCCACAG No data
Right 965242322 3:166217722-166217744 CTGACTAATCTTTAAATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965242312 Original CRISPR CTGTGGAAGGCTGAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr