ID: 965242738

View in Genome Browser
Species Human (GRCh38)
Location 3:166224770-166224792
Sequence TGCCCTTTGGAACCCCTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965242733_965242738 0 Left 965242733 3:166224747-166224769 CCAGTTGGAGGTACAAGGTACCA No data
Right 965242738 3:166224770-166224792 TGCCCTTTGGAACCCCTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965242738 Original CRISPR TGCCCTTTGGAACCCCTAAG GGG Intergenic
No off target data available for this crispr