ID: 965244405

View in Genome Browser
Species Human (GRCh38)
Location 3:166248993-166249015
Sequence GAGGCCTCTCGGCCTGTTAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965244405_965244409 4 Left 965244405 3:166248993-166249015 CCGGTAACAGGCCGAGAGGCCTC No data
Right 965244409 3:166249020-166249042 TAAACTATAGTTTTGTGGTCTGG No data
965244405_965244412 12 Left 965244405 3:166248993-166249015 CCGGTAACAGGCCGAGAGGCCTC No data
Right 965244412 3:166249028-166249050 AGTTTTGTGGTCTGGGCCCAGGG No data
965244405_965244411 11 Left 965244405 3:166248993-166249015 CCGGTAACAGGCCGAGAGGCCTC No data
Right 965244411 3:166249027-166249049 TAGTTTTGTGGTCTGGGCCCAGG No data
965244405_965244408 -1 Left 965244405 3:166248993-166249015 CCGGTAACAGGCCGAGAGGCCTC No data
Right 965244408 3:166249015-166249037 CAGAGTAAACTATAGTTTTGTGG No data
965244405_965244410 5 Left 965244405 3:166248993-166249015 CCGGTAACAGGCCGAGAGGCCTC No data
Right 965244410 3:166249021-166249043 AAACTATAGTTTTGTGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965244405 Original CRISPR GAGGCCTCTCGGCCTGTTAC CGG (reversed) Intergenic
No off target data available for this crispr