ID: 965244408

View in Genome Browser
Species Human (GRCh38)
Location 3:166249015-166249037
Sequence CAGAGTAAACTATAGTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965244403_965244408 3 Left 965244403 3:166248989-166249011 CCTTCCGGTAACAGGCCGAGAGG No data
Right 965244408 3:166249015-166249037 CAGAGTAAACTATAGTTTTGTGG No data
965244402_965244408 4 Left 965244402 3:166248988-166249010 CCCTTCCGGTAACAGGCCGAGAG No data
Right 965244408 3:166249015-166249037 CAGAGTAAACTATAGTTTTGTGG No data
965244405_965244408 -1 Left 965244405 3:166248993-166249015 CCGGTAACAGGCCGAGAGGCCTC No data
Right 965244408 3:166249015-166249037 CAGAGTAAACTATAGTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965244408 Original CRISPR CAGAGTAAACTATAGTTTTG TGG Intergenic
No off target data available for this crispr