ID: 965244409

View in Genome Browser
Species Human (GRCh38)
Location 3:166249020-166249042
Sequence TAAACTATAGTTTTGTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965244402_965244409 9 Left 965244402 3:166248988-166249010 CCCTTCCGGTAACAGGCCGAGAG No data
Right 965244409 3:166249020-166249042 TAAACTATAGTTTTGTGGTCTGG No data
965244405_965244409 4 Left 965244405 3:166248993-166249015 CCGGTAACAGGCCGAGAGGCCTC No data
Right 965244409 3:166249020-166249042 TAAACTATAGTTTTGTGGTCTGG No data
965244406_965244409 -7 Left 965244406 3:166249004-166249026 CCGAGAGGCCTCAGAGTAAACTA No data
Right 965244409 3:166249020-166249042 TAAACTATAGTTTTGTGGTCTGG No data
965244403_965244409 8 Left 965244403 3:166248989-166249011 CCTTCCGGTAACAGGCCGAGAGG No data
Right 965244409 3:166249020-166249042 TAAACTATAGTTTTGTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965244409 Original CRISPR TAAACTATAGTTTTGTGGTC TGG Intergenic
No off target data available for this crispr