ID: 965246369

View in Genome Browser
Species Human (GRCh38)
Location 3:166276140-166276162
Sequence TTTTTCCCTGTACCTTGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965246365_965246369 14 Left 965246365 3:166276103-166276125 CCTCAGAGTGTGACACTTTTATG No data
Right 965246369 3:166276140-166276162 TTTTTCCCTGTACCTTGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965246369 Original CRISPR TTTTTCCCTGTACCTTGAAT GGG Intergenic
No off target data available for this crispr