ID: 965249717

View in Genome Browser
Species Human (GRCh38)
Location 3:166327597-166327619
Sequence CTATTGGAATTGTGAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965249717_965249725 7 Left 965249717 3:166327597-166327619 CCATCTTCTCACAATTCCAATAG No data
Right 965249725 3:166327627-166327649 TCCAATGGGGACTCTATGTGGGG 0: 2
1: 13
2: 142
3: 986
4: 1901
965249717_965249727 8 Left 965249717 3:166327597-166327619 CCATCTTCTCACAATTCCAATAG No data
Right 965249727 3:166327628-166327650 CCAATGGGGACTCTATGTGGGGG 0: 5
1: 53
2: 729
3: 1575
4: 1628
965249717_965249721 -7 Left 965249717 3:166327597-166327619 CCATCTTCTCACAATTCCAATAG No data
Right 965249721 3:166327613-166327635 CCAATAGGCAGTGCTCCAATGGG No data
965249717_965249723 5 Left 965249717 3:166327597-166327619 CCATCTTCTCACAATTCCAATAG No data
Right 965249723 3:166327625-166327647 GCTCCAATGGGGACTCTATGTGG 0: 3
1: 9
2: 114
3: 951
4: 1889
965249717_965249724 6 Left 965249717 3:166327597-166327619 CCATCTTCTCACAATTCCAATAG No data
Right 965249724 3:166327626-166327648 CTCCAATGGGGACTCTATGTGGG 0: 3
1: 9
2: 130
3: 1006
4: 1967
965249717_965249719 -8 Left 965249717 3:166327597-166327619 CCATCTTCTCACAATTCCAATAG No data
Right 965249719 3:166327612-166327634 TCCAATAGGCAGTGCTCCAATGG No data
965249717_965249722 -6 Left 965249717 3:166327597-166327619 CCATCTTCTCACAATTCCAATAG No data
Right 965249722 3:166327614-166327636 CAATAGGCAGTGCTCCAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965249717 Original CRISPR CTATTGGAATTGTGAGAAGA TGG (reversed) Intergenic
No off target data available for this crispr