ID: 965251334

View in Genome Browser
Species Human (GRCh38)
Location 3:166348297-166348319
Sequence AGTTATCTGCAGAAGATTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965251333_965251334 4 Left 965251333 3:166348270-166348292 CCAAGAGCTGTCTCTCAAAAGAA 0: 15
1: 201
2: 219
3: 189
4: 415
Right 965251334 3:166348297-166348319 AGTTATCTGCAGAAGATTCCAGG No data
965251332_965251334 15 Left 965251332 3:166348259-166348281 CCAGTAACAGACCAAGAGCTGTC 0: 13
1: 174
2: 196
3: 141
4: 196
Right 965251334 3:166348297-166348319 AGTTATCTGCAGAAGATTCCAGG No data
965251331_965251334 16 Left 965251331 3:166348258-166348280 CCCAGTAACAGACCAAGAGCTGT 0: 13
1: 193
2: 204
3: 150
4: 243
Right 965251334 3:166348297-166348319 AGTTATCTGCAGAAGATTCCAGG No data
965251330_965251334 25 Left 965251330 3:166348249-166348271 CCATTGAAGCCCAGTAACAGACC No data
Right 965251334 3:166348297-166348319 AGTTATCTGCAGAAGATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965251334 Original CRISPR AGTTATCTGCAGAAGATTCC AGG Intergenic
No off target data available for this crispr