ID: 965272579

View in Genome Browser
Species Human (GRCh38)
Location 3:166638202-166638224
Sequence ACGGGGATCCTGCTTGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965272579_965272589 7 Left 965272579 3:166638202-166638224 CCAGGGACAAGCAGGATCCCCGT No data
Right 965272589 3:166638232-166638254 GAGTTGGGGCAGGAGCTCCCTGG No data
965272579_965272582 -7 Left 965272579 3:166638202-166638224 CCAGGGACAAGCAGGATCCCCGT No data
Right 965272582 3:166638218-166638240 TCCCCGTCCCTTCTGAGTTGGGG No data
965272579_965272581 -8 Left 965272579 3:166638202-166638224 CCAGGGACAAGCAGGATCCCCGT No data
Right 965272581 3:166638217-166638239 ATCCCCGTCCCTTCTGAGTTGGG No data
965272579_965272590 8 Left 965272579 3:166638202-166638224 CCAGGGACAAGCAGGATCCCCGT No data
Right 965272590 3:166638233-166638255 AGTTGGGGCAGGAGCTCCCTGGG No data
965272579_965272586 -3 Left 965272579 3:166638202-166638224 CCAGGGACAAGCAGGATCCCCGT No data
Right 965272586 3:166638222-166638244 CGTCCCTTCTGAGTTGGGGCAGG No data
965272579_965272580 -9 Left 965272579 3:166638202-166638224 CCAGGGACAAGCAGGATCCCCGT No data
Right 965272580 3:166638216-166638238 GATCCCCGTCCCTTCTGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965272579 Original CRISPR ACGGGGATCCTGCTTGTCCC TGG (reversed) Intergenic
No off target data available for this crispr