ID: 965272582

View in Genome Browser
Species Human (GRCh38)
Location 3:166638218-166638240
Sequence TCCCCGTCCCTTCTGAGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965272579_965272582 -7 Left 965272579 3:166638202-166638224 CCAGGGACAAGCAGGATCCCCGT No data
Right 965272582 3:166638218-166638240 TCCCCGTCCCTTCTGAGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965272582 Original CRISPR TCCCCGTCCCTTCTGAGTTG GGG Intergenic
No off target data available for this crispr