ID: 965272586

View in Genome Browser
Species Human (GRCh38)
Location 3:166638222-166638244
Sequence CGTCCCTTCTGAGTTGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965272579_965272586 -3 Left 965272579 3:166638202-166638224 CCAGGGACAAGCAGGATCCCCGT No data
Right 965272586 3:166638222-166638244 CGTCCCTTCTGAGTTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965272586 Original CRISPR CGTCCCTTCTGAGTTGGGGC AGG Intergenic
No off target data available for this crispr