ID: 965272589

View in Genome Browser
Species Human (GRCh38)
Location 3:166638232-166638254
Sequence GAGTTGGGGCAGGAGCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965272579_965272589 7 Left 965272579 3:166638202-166638224 CCAGGGACAAGCAGGATCCCCGT No data
Right 965272589 3:166638232-166638254 GAGTTGGGGCAGGAGCTCCCTGG No data
965272583_965272589 -10 Left 965272583 3:166638219-166638241 CCCCGTCCCTTCTGAGTTGGGGC No data
Right 965272589 3:166638232-166638254 GAGTTGGGGCAGGAGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965272589 Original CRISPR GAGTTGGGGCAGGAGCTCCC TGG Intergenic
No off target data available for this crispr