ID: 965272590

View in Genome Browser
Species Human (GRCh38)
Location 3:166638233-166638255
Sequence AGTTGGGGCAGGAGCTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965272579_965272590 8 Left 965272579 3:166638202-166638224 CCAGGGACAAGCAGGATCCCCGT No data
Right 965272590 3:166638233-166638255 AGTTGGGGCAGGAGCTCCCTGGG No data
965272583_965272590 -9 Left 965272583 3:166638219-166638241 CCCCGTCCCTTCTGAGTTGGGGC No data
Right 965272590 3:166638233-166638255 AGTTGGGGCAGGAGCTCCCTGGG No data
965272584_965272590 -10 Left 965272584 3:166638220-166638242 CCCGTCCCTTCTGAGTTGGGGCA No data
Right 965272590 3:166638233-166638255 AGTTGGGGCAGGAGCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965272590 Original CRISPR AGTTGGGGCAGGAGCTCCCT GGG Intergenic
No off target data available for this crispr