ID: 965272703

View in Genome Browser
Species Human (GRCh38)
Location 3:166638806-166638828
Sequence CTTCCACCCAGGAACCTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965272703_965272714 19 Left 965272703 3:166638806-166638828 CCAGACAGGTTCCTGGGTGGAAG No data
Right 965272714 3:166638848-166638870 TGCCCACCTTCAGGCCAGGGAGG No data
965272703_965272710 10 Left 965272703 3:166638806-166638828 CCAGACAGGTTCCTGGGTGGAAG No data
Right 965272710 3:166638839-166638861 CCCAGTGAGTGCCCACCTTCAGG No data
965272703_965272712 15 Left 965272703 3:166638806-166638828 CCAGACAGGTTCCTGGGTGGAAG No data
Right 965272712 3:166638844-166638866 TGAGTGCCCACCTTCAGGCCAGG No data
965272703_965272713 16 Left 965272703 3:166638806-166638828 CCAGACAGGTTCCTGGGTGGAAG No data
Right 965272713 3:166638845-166638867 GAGTGCCCACCTTCAGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965272703 Original CRISPR CTTCCACCCAGGAACCTGTC TGG (reversed) Intergenic
No off target data available for this crispr