ID: 965272710

View in Genome Browser
Species Human (GRCh38)
Location 3:166638839-166638861
Sequence CCCAGTGAGTGCCCACCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965272707_965272710 -1 Left 965272707 3:166638817-166638839 CCTGGGTGGAAGGGAGCAGGTCC No data
Right 965272710 3:166638839-166638861 CCCAGTGAGTGCCCACCTTCAGG No data
965272703_965272710 10 Left 965272703 3:166638806-166638828 CCAGACAGGTTCCTGGGTGGAAG No data
Right 965272710 3:166638839-166638861 CCCAGTGAGTGCCCACCTTCAGG No data
965272698_965272710 29 Left 965272698 3:166638787-166638809 CCATGAATGGCAACAGGAGCCAG No data
Right 965272710 3:166638839-166638861 CCCAGTGAGTGCCCACCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965272710 Original CRISPR CCCAGTGAGTGCCCACCTTC AGG Intergenic
No off target data available for this crispr