ID: 965272714

View in Genome Browser
Species Human (GRCh38)
Location 3:166638848-166638870
Sequence TGCCCACCTTCAGGCCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965272703_965272714 19 Left 965272703 3:166638806-166638828 CCAGACAGGTTCCTGGGTGGAAG No data
Right 965272714 3:166638848-166638870 TGCCCACCTTCAGGCCAGGGAGG No data
965272707_965272714 8 Left 965272707 3:166638817-166638839 CCTGGGTGGAAGGGAGCAGGTCC No data
Right 965272714 3:166638848-166638870 TGCCCACCTTCAGGCCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965272714 Original CRISPR TGCCCACCTTCAGGCCAGGG AGG Intergenic
No off target data available for this crispr